iCRiSAT Watch

The Cereal Tillers. 1st ICC India Grains Conference

2012-01-29T14:31:00.001+08:00

MANILA - When I write, I think of a word that stands for a world, and when it comes out, I know the concept is always greater than when I began. Today, I found in my memory a poem that was published 148 years ago, in 1863 (Wikipedia) when the National Hero of the Philippines Jose Rizal was only 2 years old, and that I memorized when I was 16 years old. The word is grain and it's found in this poem by the British poet William Blake, Auguries of Innocence:

To see a world in a grain of sand
And a heaven in a wild flower
Hold infinity in the palm of your hand
And eternity in an hour.

I see a world in a grain of cereal, if it be barley, corn, fonio, millet, oat, rice, rye, sorghum, triticale, or wheat. Out of the 10, I see in corn, millets, rice, and sorghums the semi-arid tropics of Africa and Asia. With those grains, I see the drylands' poor families of cereal tillers in the villages. By the hundreds of millions.

I see Europe interested in the drylands poor through Austria, through the International Association for Cereal Science and Technology - ICC is the popular acronym, because it was founded and became well known as the International Association for Cereal Chemistry. Then it took on a bigger role, covering a bigger universe: cereal science and technology.

And thus we find the ICC in India collaborating with the International Crops Research Institute for the Semi-Arid Tropics (ICRISAT) in conducting the very 1st ICC India International Grains Conference 16-18 January 2012 in New Delhi. The theme of the conference was "Developments in Grain Science and Technology to Ensure High Quality, Safe and Healthy Grain-Based Foods."

The aims of the conference were to: (a) advance knowledge and understanding of grain science and technology, (b) influence global trends in grain and grain food quality, nutritional value, and safety, (c) identify areas for development, (d) provide a forum for the exchange of information, and (e) promote the aims of ICC and ICRISAT. (a) is to instruct, (b) is to influence, (c) is to identify gaps of theory and practice, (d) is to inform each other, and (e) is to increase the institutional reaches of both ICC and ICRISAT as new partners. ICRISAT is now the 1st ICC institutional member in India. ICC Secretary General & CEO Roland E Poms spoke of the importance of this partnership in developing an R&D program on cereals to contribute to food security, safety and health of the people.

This new partnership must be a marriage made in drylands heaven. Since its founding in 1955, the ICC has revolutionized the cereal industry by developing standard methods to measure food quality, safety and security; since its founding in 1972, ICRISAT has revolutionized agriculture science by coming out with schemes and systems to bring the producers of foods in the drylands out of their age-old poverty.

More individuals and institutions should know more. Among the invited speakers to the international grains conference were Vilas Sinkar of VP Unilever Research based in India, V Prakash of the Indian Nutritional Society, Kiran Sharma of ICRISAT's Agribusiness and Innovation Platform, V Singh of CFTRI India, Divir Jayas of the Research University of Manitoba in Canada, DS Brar of the International Rice Research Institute in the Philippines, Kaisa Poutanen of VTT Finland, Peter Shewry of Rothamsted Research in UK, Frank Thielecke of Cereal Partners Worldwide in Switzerland, Meinolf Lindhauer of Max Rubner Nutrition and Food Institute in Germany, and Wang Wei of the Grain Storage Institute in China.

Specifically, the conference was about grain-based foods. Now then, for theoretical and practical purposes, it is not food until it is travelling the market highway. If you say foods, you are assuming that they have reached the consumers; you are assuming a supply chain emanating from the farm gate up to something like the grocery cart in a supermarket in the city and the paper bag in a public market in town.

Market, market!

So far, the Market Economy is for the Market Men. Even the economists have ignored who else should benefit from the transactions of, by and for the market. In response, since 2 years ago, 2010, ICRISAT has adopted as institutional strategy what it calls Inclusive Market-Oriented Development (IMOD).

From there, ICRISAT has convinced its public-private partners to embrace the value-adding IMOD; the 1st ICC Indian grains conference shows the ICC now belongs to the group that I call ICRISAT & Partners.

At the grains conference, in his keynote address entitled "Ensuring food and nutritional security through Inclusive Market-Oriented Development (IMOD)," sharing "the vision of a prosperous, food-secure and resilient dryland tropics with our partners all over the world," ICRISAT Director General William Dar said "IMOD is a dynamic progression from subsistence towards market-oriented agriculture" that does not leave the poor farmers behind with the dust at their feet. He said further:

At ICRISAT, we believe that farming must be done as a business, and one of our critical focus areas involves fostering agro-enterprises. We do this by promoting and initiating key approaches such as public-private partnerships, increased demand for agro-input and outputs, a conducive business environment, and above all, by advocating proactive government policies.

"Our emphasis," Dar said, "is the smallholder farmers in the dryland tropics (where) in India these comprise 65% of the agricultural landscape." Inclusive Market-Oriented Development means an enterprise in itself. Inclusive means you must include the poor farmer and his family in the business plan. Market-oriented means you must include the farmer, his family, and the market in your plan. Inclusive market-oriented development means you must include the farmer, his family, and the market in seeing to it that the whole village prospers and not simply some select farmers or investors. The farmers and their families must enjoy the benefits of the value added starting from the seeds sown in the soil up to the foods on other families' tables.

I love to point out the Kenyan example of the Producers Marketing Groups (PMGs), a model for IMOD (see my "Rated O twice! When drought comes, can ICRISAT be far behind?" 23 June 2009, iCRiSAT Watch, blogspot.com). With ICRISAT and the PMGs as partners, it is the women farmers of Kenya who have been showing the world of the drylands how to be a successful farmer even if you are female, poor and maybe even illiterate. In Tanzania, farmers have been growing improved pigeon pea seeds from ICRISAT through the PMGs, those that facilitate access to seeds and other inputs, as well as access to markets. In fact, ICRISAT has been promoting the seeds of PMGs since 2003 (see my "New coffee in Kenya. In Emali, women show who's the better half," 26 February 2009, iCRiSAT Watch, blogspot.com). And the seeds of IMOD had in fact been sown as early as 10 years ago with the setting up of the Agribusiness & Innovation Platform (AIP) where "an inclusive growth and development strategy through public-private partnership is the key." The AIP is supported by the Government of Andhra Pradesh in India.

While it is true that ICRISAT handles only 2 cereals, millet and sorghum, with the PMGs, we can creatively and critically connect the pigeon pea farmers with the cereal farmers covered by the 1st ICC India international grains conference, including the rice farmers in my country the Philippines; that is to say, the best thing is to organize the cereal tillers so that they too belong to some PMGs and, with the multiplier effects, all the villagers can prosper from the sweat of their brows.

Let all those who attended the ICC India grains conference be partners: scientists, technologies, grain breeders, millers, bakers, cereal and grain food processors, suppliers and traders not only in India but also in the rest of the drylands universe.

With its standards, the ICC is there to ensure quality of foods; with the IMOD, ICRISAT & Partners are there to ensure quality of life, inclusive of the poor cereal tillers of the drylands of Africa and Asia.

Science Davids of the drylands. Growing food, growing rich

2012-01-09T08:08:00.001+08:00

PATANCHERU - It's a David picking up on another David to fight a Goliath. It's Team ICRISAT promoting the poor to grow the food for the many and grow rich at the same time. These are what dreamers dream of - the impossible.

Based in India and led by Director General William Dar, the members of Team ICRISAT think they can change the world - and I believe they can.

On 09 December 2011, Team Captain Dar spoke at the 39th Anniversary Celebration of ICRISAT, in the Annual Day Ceremony at the Anniversary Lawns, ICRISAT Patancheru, Andhra Pradesh, India. The International Crops Research Institute for the Semi-Arid Tropics was founded in 1972. Dar's speech was titled "Innovate, Grow, Prosper: Feeding the Forgotten Poor." This is part of what he said:

We, together with our partners, will elevate the role of smallholder agriculture in feeding a growing population, and [reinvent] what we do to [lighten] the plight of the forgotten poor of the drylands.

Having thought of it in the last few days, I shall now refer to the anniversary address as The Elevating Speech of 2012. Given at the ICRISAT campus in Patancheru near Hyderabad, those 33 words I have selected out make up the most audacious statement in applied Asian science that I know of since 1909, when the methods of modern agriculture were brought by the Americans to the natives of the Philippine islands.

Those elevating words make up what Team ICRISAT thinks are necessary to change the world of the poor farmers of the drylands of Africa and Asia and, in changing them, change the rest of us. From poor lands to richer harvests, from poor farmers to richer families.

Note that Dar is saying, "We, together with our partners." When it comes to partnerships for progress through socially minded science, Team ICRISAT is a leading advocate. These are, Dar said, "partnerships with purpose." The purpose? Science with the multiplier effect.

I first wrote in 2007 about ICRISAT's primary position on partnerships in doing research for development, on ICRISAT's Vision and Strategy to 2015, and I quoted (see my "To Catch an Insight," 28 September 2007, iCRiSAT Watch, blogspot.com):

Goal. To mobilize with partners cutting-edge science and institutional innovations for poverty alleviation, food security, human development and environmental protection for poor rural families in semi-arid production systems of Asia and sub-Saharan Africa.

Towards the end of 2010, ICRISAT published the ICRISAT Strategic Plan to 2020 that on the cover itself proclaimed, among other things, the importance of partnership:

our vision a prosperous, food-secure and resilient dryland tropics our mission to reduce poverty, hunger, malnutrition and environmental degradation in the dryland tropics our approach partnership-based international agricultural research-for-development that embodies science with a human face

We go back to The Elevating Speech. Now then: "We, together with our partners, will elevate the role of smallholder agriculture in feeding a growing population" - Dar is talking about them assisting the little farmers in assuming a big role in multiplying food to feed human populations that keep multiplying. That is to say, they will be assisting millions more of the small farmers in increasing their yields, decreasing their costs, increasing their incomes, increasing values along the marketing chain to benefit more people, producers and consumers alike.

Actually, this is not a dream. Actually, they started doing that years ago in Africa through Producers Marketing Groups (PMGs), at least since 2003; I first wrote about the PMGs on 23 June 2008 ("Rated O twice! When drought comes, can ICRISAT be far behind?" iCRiSAT Watch, blogspot.com).

So, ICRISAT & Partners are going to make the small farmers grow food for the population as it grows bigger? Like I said, they think they can change the world, and I believe they can.

"Never doubt that a small group of thoughtful, committed citizens can change the world. Indeed, it is the only thing that ever has" - Margaret Mead.

If they think they can, they can. Look at Steve Jobs and his team of Apple rebels. They changed the way people carried music in their heads - now you put an iPod in your back pocket and wear a headset. They changed the way people talked to people on their phones - you use an iPhone that puts in a live image. They changed the way people buy music - you download a dime a dozen from Apple iTunes. From somewhere, they are changing the way people use their personal computers - you grab an iPad and let your fingers do the walking.

It was because Steve Jobs' thoughts were different. Here is the text of the Apple ad of the late 1990s shown on TV:

Think Different
Here's to the crazy ones.
The misfits.
The rebels.
The troublemakers.
The round pegs in the square holes.
The ones who see things differently.
They're not fond of rules.
And they have no respect for the status quo.
You can praise them, disagree with them, quote them,
disbelieve them, glorify or vilify them.
About the only thing you can't do is ignore them.
Because they change things.
They invent. They imagine. They heal.
They explore. They create. They inspire.
They push the human race forward.
Maybe they have to be crazy.
How else can you stare at an empty canvas and see a work of art?
Or sit in silence and hear a song that's never been written?
Or gaze at a red planet and see a laboratory on wheels?
We make tools for these kinds of people.
While some see them as the crazy ones,
we see genius.
Because the people who are crazy enough to think
they can change the world, are the ones who do.

It was Apple's personal computer called the Macintosh, or Mac, that changed how the world looked and used the personal computer: using the mouse and looking at a monitor with a graphical user interface (GUI) - millions of us who don't use the Mac know the GUI as Windows.

It is because ICRISAT & Partners think different. They are going to change the world of the drylands, aren't they? Yes, like Steve Jobs and Apple, through innovation.

We will "[reinvent] what we do to [lighten] the plight of the forgotten poor of the drylands" - This is the first time I've heard of a research center anywhere in the world taking a second look at its own methods of research for development. With that, I understand Team Captain William Dar as saying the public, private, people-based, and patron sectors in each country in the drylands will have to make some paradigm shifts, at the very least to discard the old approach that the experts know best, and eschew the mindset that the poor & ignorant cannot help themselves.

And Team ICRISAT knows that if you want to change the world, you have to change yourself first. Dar also said in that elevating speech:

One year ago, we agreed to think creatively and innovatively, to be open to change, to take risks, to get out of our comfort zones, to build our capacities and partnerships, and not to just do business as usual. We committed to a stronger teamwork, to a systems perspective, and to cultural change towards a learning and sharing organization.

In the past year, Team ICRISAT has been renewing and reinvigorating itself in a big way, internalizing the parts and the whole of inclusive market-oriented development, IMOD, which for the next 10 years is the Institute's driving force. To them I say:

May the Force be with you!

Poor farmers competitive? Value Chain for ICRISAT Nigeria

2011-12-31T06:51:00.001+08:00

MANILA - Nigeria has intrigued me, as I have known of Nigerian pastor Dee Eluwa whose wife Arlene Escalante is a Filipina; Dee is a fiery campaigner for Christian champions - he has the rich experience and the rich language for it, with a sharp mind and sharp English. Indeed he can add value to any chain of verses from the Old Testament and the New Testament. I should know; I, Filipino was consultant to his & his wife's book Champions Live! In 2009. I understand English is the national language of Nigeria; this Nigerian is teaching me that we can be competitive using a foreign language in adding value upon value.

And we learn that the poor farmers of Africa and Asia can be competitive using an American business concept called value chain. Thus, Nigeria intrigues me similarly today as the International Crops Research Institute for the Semi-Arid Tropics talks of a "Stakeholders' workshop on sorghum, pearl millet and groundnut value chain development held in Nigeria" (ICRISAT Happenings 1495, 02 December 2011). It looks to me like Nigeria is championing the model invented by Michael Porter, that of the value chain embraced by business beginning in the mid-1980s, and now being embraced by agriculture. Value chain agriculture? Now we shouldn't go out of the farmgate without it.

Building Competitiveness in African Agriculture (A Guide To Value Chain Concepts and Applications) was published in 2010 by the World Bank and written by C Martin Webber & Patrick Labaste (187 pages, downloadable as pdf, worldbank.org). We learn that overall, Building Competitiveness is centered on the fact that the gross domestic product (GDP) dp)gross domestic product (t ee in the philippines.in agriculture is about 4 times more effective in raising incomes of extremely poor people than the GDP arising from outside agriculture (World Development Report, 2008, cited by Webber & Labaste). The poor soils can be made richer with value chain investments.

Specifically, the World Bank guidebook considers the value chain in trying to build global competitiveness surrounding, among others, the domestic catfish of Nigeria. The market study by Michael Gorman & Martin Webber started on the given that Nigeria has become one of the largest fish importers in the developing world, dramatizing local demand versus local supply. The study concludes that with the Nigerian catfish, "there is room for value chain collaboration centered on production, investment in transport and infrastructure, marketing, commercialization, and vertical integration."

Whatever those terms mean, noting the words of Gorman & Webber in their conclusion in their study of the Nigerian fish, you can say exactly the same things about the Nigerian sorghum, pearl millet and peanut (groundnut). Thus, it is not surprising that on 23-25 November at the Tahir Guest Place Hotel in Kano, Nigeria, a 3-day workshop was held on the value chain of those 3 crops, sponsored by the ICRISAT HOPE and WASA-SP projects, led by ICRISAT Country Representative Hakeem A Ajeigbe, ICRISAT-HOPE Regional Coordinator Jupiter Ndjeunga, and WASA National Coordinator in Nigeria Lawrence Fadjana. The report on the ICRISAT workshop said:

Among the major issues raised at the workshop were: lack of consistent and reliable supply of raw grains; low access to credit; limited knowledge of agribusiness and marketing skills; poor quality standards for processed products; difficulties in registration and accreditation of small agro-enterprises; need for further research on high-yielding sorghum varieties suitable for malting and poultry feed; and strategies for linking processors to supermarkets and potential large outlets.

Translating, I look at those issues raised in that 3-crop 3-day workshop and restate them as an actual chain of values added:
(1) You have a consistent and reliable supply of grains of sorghum, or pearl millet, or peanut.
(2) You offer high access to credit.
(3) You make available and accessible knowledge of agribusiness and skills in marketing.
(4) You promote high quality standards for processed products.
(5) You facilitate registration and accreditation of small businesses.
(6) You develop high-yielding sorghum for malting and poultry feed.

(7) You offer strategies and link processors to supermarkets and other large outlets.

Those of course are not to forget that you also add a chain of values when:
(a) You sow a seed, nurture it, and it becomes many seeds.
(b) You add fertilizer and the grains of your crop become heavier.
(c) You process the grains and they become food or feed.
(d) You store the grains in a season of plenty for a season of scarcity.
(e) You bring the produce or product to the market.
(f) You bring the produce or product to the consumer's door.
(g) You bring the produce or product to the consumer's table.

As reported, the ICRISAT Nigeria 3-crop 3-day workshop was attended by more than 75 warm bodies from would-be partners in the public, private and people sectors, including biscuit manufacturers, oil millers, machine fabricators, the Dawanu market (the largest wholesale cereal market in West Africa), and representatives of farmers' associations. Note: They are all would-be value adders.

The workshop saw presentations on the opportunities and constraints facing value chain actors and their roles and group sessions clustered by commodity to analyze the strengths, weaknesses, opportunities and threats (SWOT) of each of the three commodity chains.

Thinking of the value chain, there are at least 3 things to consider with SWOT analysis:
(1) You have to have an organization that covers all the bases.
(2) You may fail to distinguish an opportunity from a threat.
(3) You may not be able to define successfully your strengths, and therefore, your weaknesses.

To help the poor farmers, SWOT or no SWOT, if I understand ICRISAT well, you need farmers' associations that are in fact public-private-people partnerships (the 4 Ps) the likes of the Producer Marketing Groups (PMGs) in Africa that ICRISAT has been nurturing for at least 10 years. The IMOD Strategy of ICRISAT calls for inclusion of the poor farmers in market-oriented development; that is to say, they must enjoy the chain of values added along the way from the seed in the soil to the food on the plate. The PMGs insure that the poor farmers are included in every link of the chain of values added.

Michael Porter sees his concept of the value chain as a weapon for a rich private business' competitiveness; I see the IMOD idea of value chain as a weapon for poor farmer business' competitiveness - we must make the farmers businessmen, and the 4 Ps must help them become competitive by themselves, otherwise their farming will never be sustainable.

For instance, for rice in Vietnam, producers sell at 87, assemblers at 93, millers at 153, wholesalers at 165, and retailers at 172 (ruraldevelopment.info). Why can't the poor farmer producers benefit from the added value in every step of the way? They can. The producers of rice can enjoy the chain of values added by being essentially the assemblers themselves, the millers of their own rice, the wholesalers of their stocks, and the retailers of their grains.

Competitiveness is not in the vocabulary of farmers, especially the poor, and neither is it in the vocabulary of scientists working with the farmers. ICRISAT's work on value chain, which started years ago, now includes poor farmers' competitiveness. ICRISAT does not actually use the word "competitiveness" in discussing the value chain, but I see that the Institute's African model of the value chain of poor farmers called Producers Marketing Group is actually building competitive advantage in every step of the way, from input to throughput to output, by reducing costs, reducing losses, and increasing returns.

Now then, with the value chain working in favor of all actors in the drama of development, the poor farmers can indeed enjoy many happy returns of the day!

ICRISAT's AI. Aggie innovation & partnerships in Africa & Asia

2011-12-11T19:09:00.001+08:00

MANILA - Awareness + interest heightened must have been what led me to desire action beyond approbation of events involving the International Crops Research Institute for the Semi-Arid Tropics (ICRISAT) in Africa and Asia, when I read the 15 November 2011 issue of ICRISAT Happenings (downloadable as pdf, icrisat.org). Would you believe it was a revelation?

I have been reading ICRISAT Happenings since 2009, even if it is really an insider newsletter, and this time I was pleasantly surprised that this single issue showed the great variety of ICRISAT endeavors, the Institute’s plans and projects, including a brief report on science officials from my country the Philippines to learn about how science can give multiple births to businesses, and I was delighted that I can summarize them all in only 2 letters - AI. Like so:

Attention & Investment
Agribusiness Incubation
Action ICRISAT
Assets Improvement as Innovation in Agriculture
African-Asian Interchange

1. Attention & Investment

"Small farmers need more attention and resources to succeed," ICRISAT Director General William Dar told the World Agricultural Forum (WAF) 2011 Congress in Brussels late last month, November. He was moderating the session on "The Role of South-South Partnerships" and was referring specifically to the collaboration between India and Africa. South-South partnerships refer to the developing countries helping each other develop.

The Africa-India partnership aims not only to grow food but more so to improve the overall livelihoods of small farmers in the drylands. "We believe that South-South partnership is the key to solving hunger and poverty and in stimulating a greener, more productive drylands," Dar said. A "greener, more productive drylands" means more fertile soils growing more verdant crops in the semi-arid tropics of Asia and Africa. ICRISAT & Partners have the technologies, including the seeds and systems to help push what former IRRI Director General MS Swaminathan calls the Evergreen Revolution. The International Rice Research Institute (IRRI) was the origin of Miracle Rice that brought about the Green Revolution in Asia. The problem the Green Revolution was not IRRI's Miracle Rice but the fact that it was not sustainable. Frank H says the Green Revolution went on to enrich investors, but not the farm resources, and not the farmers, but of whom were still poor if not now poorer. It was neither community-conscious nor conservation-conscious. For the Evergreen Revolution, Dar said, "it is necessary to simultaneously achieve the multiple goals of food, nutrition, economic and environment security for the rural poor." For everyone.

2. Agribusiness Incubation

One of the proactive efforts coming from science, public and private sectors is Agribusiness Incubation. I learned about ICRISAT's AI - the Institute writes it thus, Agri-Business Incubation and, so, uses the acronym ABI - first in 2008 and wrote about it (see my "Science's 4-Way Test. If it tests good, I must be in the drylands," 04 December 2008, iCRiSAT Watch, blogspot.com). ICRISAT's AI is its institutional way of encouraging entrepreneurship among the private sector. The incubation setup at ICRISAT's Patancheru campus in India helps fledgling businesses, nascent devices, with expert advice, facilities, technologies, and equipment from ICRISAT. With AI, 2 years ago, ICRISAT & Partners, including the Government of India, announced the world's first commercially successful ethanol production from sweet sorghum, with poor farmers supplying the feedstock to Rusni Distilleries (see my "India & ICRISAT. Thinking outside the box of science," 16 March 2009, iCRiSAT Watch, blogspot.com).

We need to "tap into the innate entrepreneurial spirit existing in the agricultural community," Dar said at the Food 360°, an international conference on food processing held at Andhra Pradesh 21-22 November and organized by the Federation of Indian Chambers of Commerce & Industry. This way, "Modernizing the agro-food system can be a strong engine for (economic) growth and poverty reduction in the drylands."

Others are into business incubation. For instance, the Universities, Business and Research in Agricultural Innovation (UniBRAIN) is a program of the Forum for Agricultural Research in Africa (FARA); in UniBRAIN, FARA is being supported by the Royal Danish Ministry of Foreign Affairs (DANIDA). During the UniBRAIN training program on agribusiness innovation incubation held in November 2011 at the ICRISAT Patancheru campus, Dar welcomed the trainees and said, "Agribusiness incubation plays a direct role in ensuring food security and poverty reduction" (25 November 2011, Happenings 1494, icrisat.org). That is, because most agribusiness incubators operate in the villages, "there is a direct impact on creating employment opportunities and income generation for the rural poor." In a value-chain model, as a business grows in the village, so must the villagers.

3. Action ICRISAT

In the last several months of this year, the Change Management Team (CMT) of ICRISAT has been working on the Institute's Cultural Change Plan of Action. The members of the team are Dave Hoisington, Hector Hernandez, Peter Ninnes, Rex Navarro, Rajesh Agrawal, Farid Waliyar and Said Silim. Subsequently, the team has identified 5 shared values and 5 cultural change areas as the main drivers of ICRISAT's Cultural Change.

The five shared values are: practicing strategic and systematic thinking, showing the way, working for results, respecting everyone, and communicating for understanding. While these are not articulated in such an explicit manner, these are corporate values espoused by the Institute. Such values are, Ray B Williams says, those "containing notions of strong positive cultures" (07 February 2010, psychologytoday.com). Now that they have in fact been articulated inside of ICRISAT, we can expect more expressions of these and their enhancement by Team ICRISAT.

The five key cultural change areas are: impact orientation, learning and knowledge sharing, innovation, partnership & networking, and gender & diversity. You can interpret "key cultural change areas" as either of 2 things: (1) paramount policies to be emphasized by the Institute to achieve desired changes in clienteles within their contexts, and (2) fundamental features desired in programs and projects of ICRISAT & Partners.

4. Assets Improvement as Innovation in Agriculture (AI-IA)

Borrowing from Robert Kiyosaki - I read his books, including Rich Dad, Poor Dad, years ago - a resource is not an asset if it doesn't give you income; following this line of reasoning, I can see that if you want continual optimal income from your soil, you cannot abuse it; you have to conserve it, like returning the richness that you obtain from it in the form of your harvests of fruits & vegetables - the macro plant nutrients as well as the micro; and like preventing soil erosion by maintaining the organic matter (OM) content of your field, as the OM holds the soil particles together. Certainly, ICRISAT espouses the virtues of organic fertilizers such as those obtained from vermiculture and sweet sorghum bagasse.

The India Economic Summit 2011 was held in Mumbai on 12 November 2011 with the theme "Sustainable Growth Summit." If you want sustainable growth, you have to develop your assets and/or maintain them optimally.

For sustainable growth, water is an asset you cannot do without. There was this 18-19 November 2011 international meeting of 55 scientists and science advocates from the World Economic Forum, International Water Management Institute, International Finance Corporation, Government of Karnataka, state universities, International Water Management Institute (IWMI), private companies and ICRISAT held at the Patancheru campus of ICRISAT in India. It was the "Workshop on developing water-enabled sustainable agricultural growth in Karnataka." At the close of the workshop, they agreed to conduct 2 pilots in 2 command areas in Karnataka good for 100,000 hectares each. IWMI and ICRISAT will prepare the detailed action plans.

What's with water as an asset for continuing growth in the villages? Where the village is dry, as it was once in the Adarsha community in India, the building or rebuilding of the watershed for and by the villagers becomes imperative. Adarsha is one of the most inspiring and insightful science stories in recent years, and it happened with the advocacy and assistance of ICRISAT & Partners, not to mention the intelligence and initiatives of the villagers themselves. The story of Adarsha is an excellent example of the application of ICRISAT's mantra, "Science with a human face." (For more details on Adarsha, you can begin with my "The Turning Point. Know that silent water runs deep," 04 October 2007, iCRiSAT Watch, blogspot.com).

5. African-Asian Interchange (AAI)

On 23 March 2011, ICRISAT announced to the world the birth of the ICRISAT South-South Initiative (IS-SI) "to boost India-Africa partnership on agricultural research-for-development to fight poverty in the drylands" (24 March 2011, icrisat.org). “IS-SI will build upon ICRISAT’s already strong and successful India-Africa partnerships to scale up its role as driver of prosperity and economic opportunities in the dryland tropics,” Nigel Poole said. He was speaking as Chairman of the Governing Board of ICRISAT to some 40 participants of the India-Africa Roundtable on Agriculture for Development held in New Delhi that day.

So why is the South helping the South and not the North helping the South? Frank H says perhaps the North does not appreciate the fact that, as according to ICRISAT Team Captain William Dar, for every single US dollar spent on international research in agriculture, the return on investment is 9 US dollars' worth of economic value in developing countries. In other words, even given the ROI, the North is not helping the South enough to make a world of difference, especially among the poorest of the poor.

With the inclusive market-oriented development (IMOD) paradigm, ICRISAT & Partners are interested in promoting entrepreneurship among the poor in farming communities, the value chain starting from raw materials to foreign markets. So far, the North is entrepreneurial enough within its comfort zone but not outside the box. Does that mean the North doesn't have enough creative capitalism in its head, not to mention its heart?

Forum for farmers. Food, fuel, forage, feed, fertilizer & family?

2011-12-01T04:22:00.001+08:00

BRUSSELS - Sprouts are expected from 28 November to 01 December 2011 in the World Agricultural Forum-sponsored World Congress 2011 as scientists & partners sow new seeds of technology for the farmers of the world, as investors tend to their new gardens of responsible resource use, as everyone tries to reconcile strengths with weaknesses, resolve opportunities with threats in a world confronted by adversities, not the least of which is Climate Change.

This is how the Congress' sponsor describes itself (worldagriculturalforum.net):

World Agricultural Forum (WAF) is a policy neutral and internationally inclusive agriculture forum that brings together the leaders from the private sector with policy makers and key policy influencers to focus on providing food, fuel, fibre and water to the world's growing population.

The theme of the World Congress 2011 is "Rethinking Agriculture." So, where will the poor farmers be in all those talks and thoughts?

By "poor farmers" I mean those whose poverty of knowledge prevent them from extracting the optimum benefits from the value chain that starts with the tillers' crops and ends on the consumers' tables - and those whose poverty of the spirit drive them to abuse the land, poison it, erode it, and otherwise not give back what they take from it.

The WAF itself says it "believes that progress is best achieved when all contributors to agriculturally based food, fuel and fiber understand change and are able to confer on its causes, impact and implications." I myself am interested in the impact and implications on the millions of marginalized farmers and their families in the drylands of Africa and Asia.

And so I would be expecting much Tuesday, 29 November from "Breakout Session III: Extracting Benefits for All from the Agriculture-Based Value Chain" (worldagriculturalforum.net). There, Moderator would be Ron Bonnett, Board Member of WFO & President, Canadian Federation of Agriculture (CFA/FCA, Canada), and panelists would be Tom Lambie, Chancellor & former President, Lincoln Agricultural University & Federated Farmers, New Zealand; Marc Rosiers, Advisor of the Board of Directors and Manager of the Boerenbond Study Department Boerenbond; and Knud Buhl, Director Copenhagen and Brussels Department for International Trade, Danish Bacon and Meat Council (DBMC). I would be thinking of the value chain that inclusive market-oriented development (IMOD) could bring to the farmers, who have always been the last to be remembered. IMOD is ICRISAT & Partners' new paradigm for the poor farmers of the drylands of Africa and Asia (see my "IMOD as The iPod of Science. Out of Africa, out of poverty," 25 January 2011, iCRiSAT Watch, blogspot.com).

And on Wednesday, 30 November, I would be expecting much from the "Plenary Round Table: A New Vision for Agriculture – Market-Based Solutions." There, Moderator would be Robert Berendes, Head of Business Development, Syngenta; and panelists would be Rainer von Mielecki, Head of Global, Public / Government Affairs Crop Protection, BASF; David Cleary, Global Agricultural Lead, The Nature Conservancy; and Willem-Jan Laan, Director Global External Affairs, Unilever. I would be thinking of the poor farmers IMOD-driven by public and private partnerships, the cultivators of the soil being linked directly to local as well as global markets, enjoying the benefits thereof. The WAF itself would understand as it prides itself that is "known for its regular all-inclusive World Congress." (my italics)

And I would be expecting much Thursday, 01 December, from the "Round Table: Trends and Developments in Private Financing of Agriculture." There, Moderator would be Philippe de Lapérouse, Managing Director, Global Food, Agribusiness and Biofuels, HighQuest Partners LLC; and panelists would be Daniel Hough, European Head, Macquarie Agricultural Funds Management; Rui Laurentino, Founder and CEO, Qufiel Resources, Portugal; and Nathalie Brisbois, Manager, Enterprise Fund of the Belgian Investment Company for Developing Countries (BIO). I would be thinking among other things of funds spent on Creative Capitalism as Bill Gates would have it (see my "Bill Gates, Nobel Prize for Economics 2008! Well he inspires US to Creative Science," 28 October 2008, iCRiSAT Watch, blogspot.com).

But I would be expecting much more the day before, Wednesday, 30 November, from the "Breakout Session II: Re-thinking Agriculture – The Role of South-South Partnerships." There, Moderator would be William Dar, Director General, ICRISAT (India), and the panelists would be Arvind Kumar, Deputy Director General for Education, Indian Council of Agricultural Research (ICAR); Said Silim, Director of East and South Africa Region, ICRISAT; and Monty Jones, Executive Director & Winner of 2004 World Food Prize FARA, Agricultural Research in Africa (FARA), Ghana. Where North refers to a well-developed country, South refers to a less-developed one. South-South Partnerships are those less-prosperous countries helping each other where there are no North-South partnerings for development. If nobody else will, you help those with whom you help yourselves. My great interest in this session stems from the fact that Dar's ICRISAT & Partners are pro-poor.

"Rethinking Agriculture." The WAF says of its congresses, "There is a high focus on hunger and poverty." So, Congress 2011 is supposed to be a forum for poor farmers and their families too, or mostly. OK. Now, may we remind you ladies & gentlemen, that if you are a poor farmer, you worry about fuel for your stove, food for your family, forage & feed for your animals, fertilizer for your crop, and income for your family. And not to forget, you worry about the water for the home and for the farm, separately. No iPhone, no iPad to worry about.

Since the mid-1960s, I have been rethinking agriculture myself, but I couldn't find my voice. Then in 2005 my son Jomar gently nudged me into blogging, and since then I have been proclaiming to all the world: "Blogging is the revenge of the unpublished writer!" Then in 2006, I discovered American Chronicle, and have been publishing there regularly since.

Then in 2007, I discovered the International Crops Research Institute for the Semi-Arid Tropics (ICRISAT) when I discovered its Team Captain, Director General William Dollente Dar (see my "Al Gore of Science. William Dar & 'Science With A Human Face," 24 June 2007, iCRiSAT Watch, blogspot.com). And I discovered that ICRISAT is science with a human face, the face being that of the dirt-poor cultivators of the drylands of Africa and Asia; that ICRISAT has discovered public & private partners in the journey to development; that ICRISAT & Partners have discovered that the dust-poor farmers and their families must be included from end to end of the value chain in a market-oriented development paradigm (see my "ICRISAT means business. IMOD means value chain for the poor," 05 October 2011, iCRiSAT Watch, blogspot.com). And that is why I have been hugely interested in this WAF's 2011 Congress.

Invited to the world forum, ICRISAT's Dar had announced days before the Congress:

We believe that South-South partnership is the key to solving hunger and poverty and in stimulating a greener, more productive drylands. We intend to explore the synergy and leverage of India and Africa working together and putting greater investment and involvement in agricultural development. Small farmers need more attention and resources to succeed. We will pursue Public-Private Partnerships (PPP) to increase investments in agriculture from leaders in India and Africa as well as from funders and partners in the developed world. We are also looking for ways by which PPP can make a difference – whether by doing research, developing products, or opening up new markets that will benefit smallholder farmers in Asia and sub-Saharan Africa.

Nigel Poole, Chair of ICRISAT's Governing Board, himself said, "India shares similar poverty and infrastructure issues with Africa, so when successful solutions are found they need to be transferred if we really want to implement change. Reaching out to the rural poor of India and Africa with our research and technologies is a key challenge."

The poor we have always had with us - as a key challenge.

Knowledge Millennium Summit 2011. The New Evergreen Revolution

2011-11-15T05:55:00.001+08:00

NEW DELHI - We are in the Rich Knowledge Millennium, but the poor have poor knowledge of it. And there are about 1 billion of them.

"While new innovations and technologies are redefining agriculture development," the 9th Global Knowledge Millennium Summit says, "there is need [for] linking and leveraging innovations and [making] them work for society at large" (meraevents.com). The poor we have always been leaving out.

Until recently, when ICRISAT & Partners came up with what is now known as Inclusive Market-Oriented Development, the IMOD. No, it doesn't look like a revolutionary concept, until you ask what "Inclusive" means and ICRISAT Director General William Dar will tell you: "inclusive of the poor."

No, "inclusive of the poor" is not a new vocabulary, because even the World Bank had mentioned it years earlier in the book Making Transition Work for Everyone (2000, page 184, worldbank.org). What ICRISAT & Partners have done is give it a new meaning, that is, in my terms, inclusive of the poor as actors in the development drama, from producing quality local seeds to enjoying quality foreign markets. They have done in it Africa; see my "New coffee in Kenya. In Emali, women show who's the better half!" (26 February 2009, iCRiSAT Watch, blogspot.com). The women aren't always right, but they're always better.

IMOD is ICRISAT's strategy to 2020. Frank H says IMOD means that the poor actively participate from sourcing inputs to production to processing to marketing to village development, all throughout the process. The poor are no longer simply reactors; they become actors and, grouping themselves, with public and private partners, they become the businessmen and middlemen working for their own welfare. (For more details on the IMOD, see my "ICRISAT's iMODe. The village as minimum development goal," iCRiSAT Watch, 10 December 2010, blogspot.com).

Now look at the image shown here: The 3 important words are these: Agriculture * Innovations * Market. AIM@8%, targeting 8% growth in agriculture. They are holding the 9th Global Knowledge Millennium Summit (GKMS) on 08-09 November 2011 in New Delhi. This marks a qualitative change in the nature of the conference, as it is the first time they are talking of "agriculture" and "market" both of which include the poor.

The previous GKMS were as follows (assocham.org):

1st - Information Technology (1999 December)
2nd - Biotechnology The New World (2001 March)
3rd - The Business of Biotechnology (2003 March)
4th - Biotechnology and Nanotechnology (2006 March)
5th - B2B in Biotechnology and Nanotechnology (2007 September)
6th - Biotech Nanotech for Sustainable Agriculture (2009 February)
7th - Bio Pharma Emerging Health Threats: The Solution? (2009 November)
8th - "2010-2020: Decade of Innovations"; Food Security, Healthcare, Renewable Energy & Water (2010 November).

Always on innovations but they were not talking about the market; they were not talking about how much growth in agriculture they wanted; they were talking about consumers, but not talking about the poor. Now that they are, they might as well have written as their slogan:

Inclusive AIM@8%.

I like it that the listed objectives of the Summit emphasize partnership (meraevents.com):

* To deliberate and analyze hurdles in fostering public private partnership in innovations and investments
* To share innovations in technologies and services to meet agriculture development
* To seek common areas and priorities for collaboration to strengthen partnerships
* To reach consensus on planned actions to address sustainable developmental issues
* To devise strategies & plans to achieve 8% growth in agriculture.

The GKMS finally has realized that (meraevents.com):

Perhaps insufficient attention is given to the fact that the capacity for innovation in agriculture is influenced not only by farmers' skills and resources, but also by the wider network of links and relationships in which farmers are embedded, which help ideas to diffuse and find new uses.

Since they have invited ICRISAT to be part of the Global Knowledge Millennium Summit, they have accepted IMOD as the way to go in Agriculture, Innovation, and Market when it comes to the poor farmers in the drylands. They have in fact joined the next Green Revolution.

In his message to the Summit read by CLL Gowda, who is Research Program Director for Grain Legumes for ICRISAT, Director General William Dar says:

The next Green Revolution or the Evergreen Revolution (as Dr MS Swaminathan calls it) will have to be played out ... in less hospitable [habitats] such as the drylands. It will have to bring about food and nutritional security to billions of people worldwide but without further damaging the fragile [habitats]. And its long-term success will depend on a strong convergence strategy that brings together civil society and the public and private sectors through mutually beneficial partnerships that ultimately advances the agricultural sector.

The Green Revolution happened in croplands that were more fertile, much irrigated. The Evergreen Revolution will have to deal with the drylands, the badlands. And then those habitats will have to produce food without further damaging themselves such as by soil erosion or chemical poisoning. The long-term success of the new revolution, Dar says, will depend on partnerships that ultimately advance everyone, including the poor farmers.

And Third World countries, Dar says, need to invest more resources to grow food, grow incomes, and grow agriculture via extension services, infrastructure, irrigation systems, and information and communication technology. They need to grow drought-tolerant and heat-tolerant varieties to reduce the risk from Climate Change. They need to learn to use water wisely to reduce the risk that chemical fertilizers and pesticides will harm the environment.

Further, Dar says, the poor farmers in Third World countries need to access inputs as well as storage facilities, to empower themselves in order to get optimum value for their produce.

Governments need to gather and broadcast information about production, consumption and stocks to reduce price volatility. It is equally important for governments to invest more on research for development (R4D) as this has the highest impact on agricultural growth, as much as 60% in research and 50%+ in extension.

Entrepreneurs and private players need to come up with innovative products, processes and concepts to integrate into the value chain.

Given all that, William Dar says:

Together with governments, civil society organizations, the private sector and partners like ASSOCHAM, we are confident that we can make this second Green Revolution happen.¶ We owe it to the smallholder farmers and the poor people in the developing world!

Frank H says: Inclusive and Sustainable, that's the Evergreen Revolution.

ICRISAT's biotech first. Is genome sequencing of pigeon pea for us?

2011-11-08T20:55:00.001+08:00

MANILA - What in the world does "genome sequencing" mean, and why should a poor farmer of pigeon pea in the drylands of Africa or Asia care?

It's a saving crop. First of all, those who depend on pigeon pea for protein total more than 1 billion people. Pigeon pea is planted by poor farmers in 5 million hectares in Asia, Africa, South America, Central America, and the Caribbean, making it the 6th most important legume crop in the world. In Kenya, very successful farmers (women) call pigeon pea their coffee, referring to its high value, as well as their beef, referring to its high protein content (see my "New coffee in Kenya. In Emali, women show who's the better half," 26 February 2009, iCRiSAT Watch, blogspot.com). The genome sequencing of pigeon pea is a giant step towards creating an ideal crop for the drylands where the poorest of the poor farmers labor in pain, if not in vain.

"We are the first CGIAR Center that led a genome sequencing activity," ICRISAT Director General William Dar says. "The genome sequence of an organism includes the collective DNA sequences of each chromosome in the organism," Wikipedia says. Globally, "This is the first draft genome sequence for a grain legume as well as the first for an orphan or neglected legume crop," Dar says. "Probably the first for a non-industrial crop too."

Genome sequencing? Now all I have to do is make heads from tails. When scientists speak, you can be sure you have a lot to learn before you can begin to learn.

So, first things first. For big words such as those, definitions should be of great help; those in italics are from the American Heritage Dictionary:

Genome: a complete set of chromosomes with associated genes. Humans have 24 chromosomes; that's all we are. A pigeon pea has 22 chromosomes. Actually, it's more complicated than what those small numbers suggest, since the genes of plants and animals determine who exactly they become.

Chromosome: a strand of DNA and associated proteins in the nucleus of a plant or animal cell that carries the genes and functions in the transmission of hereditary information. Gene: a sequence of DNA. DNA: two long chains of nucleotides; the sequence of nucleotides determines individual hereditary characteristics.

Chromosome, gene, DNA. Question: Looking at the dictionary definitions, does the chromosome determine hereditary characteristics, or does the DNA? Answer: It's the DNA. The definition of "chromosome" should not include "functions in the transmission of hereditary information" because that's the function of the DNA.

Another question: If "the sequence of nucleotides ... determines individual hereditary characteristics," what does that make of the gene, which is "a sequence of DNA?" Actually, the sequence of nucleotides is the sequence of DNA is the gene.

And no, you cannot do a genome sequence actually; genome sequencing is a misnomer. What is actually referred to is DNA sequencing, or the "reading" of the "book of life" whose text comprises only the 4 letters A, T, C, G, corresponding to the bases adenine, thymine, cytosine, guanine that make up the DNA code.

How do scientists read the DNA? I got this idea of how to get a grasp of the reading of the DNA sequence in a delightful way from the Genome News Network (genomenewsnetwork.org); I give you my Urgtu Text:

URGTUFIVEFREWCASPIPUZZLED BOYSPORQWATCHEDMKJSIX QUIETKF
XCZGOHJDFLNURGIRLS KISSMGJSWXUTNFJUST MESLRVUFRANKKYXQ

If you hover your cursor along the lines above, each hidden word appears with an underline. The words are not obvious; a little trick and they can be read: Five puzzled boys watched six quiet girls kiss just me, Frank.

The meaning is not only that. GNN says:

When you read a sentence, the meaning is not just in the sequence of the letters. It is also in the words those letters make and in the grammar of the language. Similarly, the ... genome is more than just its sequence.

Well, reading the DNA sequence is a thousand times, maybe a million times more complicated than my Urgtu Text, but you get the idea. Remember, what you're reading is all A, C, T, G which may occur as C, T, G, A or any other random combination or sequence, and those tags are imaginary, not real. A DNA sequence would look like this if the genetic alphabet were written in the human form (example from GNN):

AGTCCGCGAATACAGGCTCGGT

A different gene, a different DNA sequence, a different location within the chromosome.

Why would scientists led by ICRISAT want to read such DNA sequences of the pigeon pea? Because they want to find out which of these are associated with characteristics such as tolerance to drought, resistance to disease. Then they can use their findings to examine their pigeon pea collection or genebank, which today comprises 13,632 accessions or acquisitions. With the Asha pigeon pea DNA sequences now more or less mapped, scientists can now study which of these sequences are associated with desired characteristics of a new pigeon pea variety. With the candidate genes located, the Asha genome can now be used as reference, and any of the 13,632 accessions can be identified as the source of genes for, say, stable resistance to diseases such as sterility mosaic and leaf spot, tolerance to pests such as the pod borer, adaptability to stresses such as drought and heat, and other quality traits such as high yields and early maturity.

Adarsha means ideal in Hindi. Armed with their knowledge of the DNA sequences of pigeon pea and gene associations with desirable characteristics of a crop, working on those tens of thousands of ICRISAT accessions, what about a new Adarsha pigeon pea variety that yields within 100 days 1,500 kg/ha or more than double the current average of 867 kg/ha in Asia, because it is resistant to drought, heat, bacterial wilt, leaf spot, and pests? That would be more than ideal.

Meanwhile, there's more work to be done. After predicting more than 48,000 genes within the pigeon pea genome, they have to accurately determine the roles of gene families for desired characteristics in terms of yield and resistance to stresses. ICRISAT & partner scientists have a long way to go to their dream of telescoping time in breeding for their ideal pigeon pea varieties. They will still have to understand how it all works out: what the genes do, how the genes are related, and how everything is coordinated. Nonetheless, in their journey of a thousand miles, they have taken the first step. And I congratulate them.

Eradicating poverty. How food can save the world's poor ever

2011-10-21T13:22:00.001+08:00

MANILA - We are at the crossroads - which road to take? We have just celebrated World Food Day on 16 October and International Day for the Eradication of Poverty on 17 October. Since 1993, we have been officially declaring the fight to erase poverty worldwide. 18 years later, we have no report of satisfactory success toward the goal. How far have we gone? It's time to look at the where and the how.

Now The Where

It can be a war on many fronts, but not for ICRISAT, and certainly not for the Bill & Melinda Gates Foundation. To fight hunger and poverty, we are investing in agriculture, says Prabhu Pingali, Deputy Director for Agricultural Development of BMGF. He is speaking in a seminar at the ICRISAT campus in Patancheru on 07 September 2011; the BMGF is currently the top donor to ICRISAT (09 September 2011, ICRISAT Happenings 1483). "The power of investing in agriculture is clear," he says. "Agricultural development is two to four times more effective at reducing hunger and poverty than any other sector." That tells me that Bill Gates has decided that his Creative Capitalism works 4 times better in agriculture than elsewhere. In his speech on 24 January 2008 at the World Economic Forum in Davos, Switzerland, Bill Gates explains Creative Capitalism as ‘an approach where governments, businesses and nonprofits work together to stretch the reach of market forces so that more people can make a profit, or gain recognition, doing work that eases the world’s inequities’ (for more details, see my “Bill Gates, Nobel Prize for Economics for 2008!” 28 October 2008, iCRiSAT Watch, blogspot.com).

But how?

Now The How

In 1972, the International Crops Research Institute for the Semi-Arid Tropics (ICRISAT) was born, and since then has been trying to help defeat hunger and poverty especially in the drylands of Africa and Asia. Up to the late 20th century, ICRISAT was pursuing the great notion that higher and higher yields will increase the poor farmers' income, hoping that there will come a time when they can stand on their own two feet indefinitely.

That, in fact, is the story of the Green Revolution. Since I'm a Filipino having lived all my 71 years in the Philippines, being a BS Agriculture '65 graduate from the University of the Philippines Los Baños, and a farmer's son, I have firsthand knowledge of how from the 70s the high yields of "Miracle Rice" of the International Rice Research Institute (IRRI) transformed the lives of many farmers and their families from rich to richest, and many more from old rags to new rags. With good IRRI rice seeds, farmer-friendly credit was too easy to obtain that it was mismanaged by functionaries on one hand and by farmers on the other hand.

Even where credit was well-managed, that was not enough to help the poor Filipino farmers rise above the poverty line and stay there. The suppliers of inputs (fertilizers, chemicals) became richer; the farmgate buyers of produce became wealthier; the rice millers became much better-off; the retailers profited more - and many farmers' lives became much better before they became much worse.

This Philippine story is the same in Asia and Africa where rice was being grown. What was missing? The Green Revolution was better agriculture, but it was not higher agriculture. The Green Revolution was a success, but it didn't move on to the next level.

The next level was equity, something to do with principles and fairness. The farmer was the producer, as well as the risk-taker: Why was he not rewarded properly for his labors and compensated appropriately for his risk-taking? Why did the virtual farm-to-market road leave him by the wayside eating the dust of the well-wheeled travelers, the middlemen?

Unfortunately, in the 20th century and even during the Green Revolution, it seems no one thought highly of the lowly farmers. Fortunately, in the 21st century, there was a rise in consciousness among scientists and advocates of dryland farmers in Africa, which gave rise to Producer Marketing Groups (PMGs), pioneered across Africa and Asia by ICRISAT (August 2008, What ICRISAT Thinks, icrisat.org).

PMGs give farmers quick and economic access to high-quality seeds and other inputs, as well as connect them to markets. Where the PMGs are, there are no middlemen - the farmers are the middlemen, so what would otherwise accrue to middlemen accrue instead to the farmers. PMGs are how poor farmers can rise above poverty - and stay on top - as they benefit from continuing collective action.

"PMGs are owned and run by the farmers or jointly with private sector partners," says ICRISAT Director General William Dar, "often with assistance from NGOs, research partners, government agencies and others." From 2003 to 2009, ICRISAT was already supporting 10 PMGs in Kenya. During the same period, farmer incomes in that country increased by 23%.

In other countries, the PMGs have managed to increase local prices of pigeon pea by up to 25% in drought-prone Nairobi and Mombassa. ICRISAT's drought-resistant pigeon pea is now considered a "lifesaver" and "guarantor of livelihoods" in those countries.

The most encouraging stories of the role of PMGs in bringing about sustainable change for the better in farming villages are from Kenya. With PMGs, Kenyan pigeon pea farmers have been enabled and encouraged to own land and livestock, including milking cows, for more returns, even mobile phones for communication. Basic needs having been met, more families now send more children to more schools; they can now afford to buy higher-quality foods - overall, the standards of living have risen.

The theme of this year's International Day for the Eradication of Poverty is "Working together out of poverty." That calls for partnerships. PMGs are partnerships at the local level, where the poor farmers are.

In 2000, when William Dar started his 1st 5-year term as Director General of ICRISAT - he is now in his 3rd term - I believe he was already thinking of building partnerships to push forward science for development (R4D), as he had authored the book Building Partnership And Capacity: A Centennial Achievement Of PCARRD published by the Philippine Council for Agriculture, Forestry, Natural Resources Research and Development. Indeed, when he became Executive Director of PCARRD, immediately he laid out a 7-point agenda, and the 2nd was "to strengthen partnerships with the private sector, non-governmental organizations, state universities and colleges, government units, and Congress of the Philippines."

At ICRISAT under Dar, the wondrous plant called Partnership was wind-pollinated by other plants called PMGs and last year, 2010, yielded the seed called Inclusive Market-Oriented Development (IMOD) to plant along the road to research for development. IMOD calls for poor farmers working with scientists, public & private advocates working along the market superhighway in more villages of Africa and Asia.

For the PMGs, and carried forward to the IMOD as a strategy, "to fully reach their potential," says Dar, "supportive steps are urgently needed in areas such as legal status, crop insurance, credit access, infrastructure, management skills, and market intelligence-gathering capabilities." With ICRISAT, the new, improved varieties of crops include drought-tolerant chickpea, peanut, pearl millet, pigeon pea, and sorghum.

So, how do you solve the world's hunger, starvation - and poverty? Food first, that is, make food available when we need it. How do you make sure that you have enough food when starvation strikes? You produce more than what we need today. And how do you insure that the farmers produce more than the current demand? You give extra help to them.

In fact, during the Green Revolution we did just that but the farmers are still poor. Why because they did not get their fair share of the values added. Then we must connect them to the market, meaning they must engage in marketing their produce themselves. But the farmers are poor, so how can they do their marketing? Then you form something like producer marketing groups to take care of everything, from inputs to exports. Then you have connected the farmers to the market. Then you are practicing science with a human face.

William Dar says:

For a long time, dryland farm families have been marginalized out of the development loop. An inclusive (broad-based) strategy puts them into the mainstream to participate and reap the benefits of development. Moreover, an inclusive strategy will enable the poor, particularly women and the youth/children, to participate, rather than be sidelined, in the development process.

Inclusive market-oriented development, IMOD, provides surplus food and higher incomes to poor farm families that are sustainable. The better incomes enable them to buy more food when necessary, as well as purchase inputs such as seeds, fertilizers, chemicals, labor, tools, livestock, insurance and education. Within the village, "These will further raise farm productivity," says William Dar, "kicking off a series of investments that bring about economic growth. As this is sustained, it creates a self-reinforcing pathway to prosperity."

IMOD is how poor farming villages can prosper more. IMOD is how more poor farming villages in Africa are prospering more. With a little help from their friends, ICRISAT, Bill Gates and other partners.

Global price volatility? I'm more worried about income stability!

2011-10-13T21:47:00.001+08:00

MANILA - We have about 1 billion poor people in the farmlands of Africa and Asia, and the latest report on "The State Of Food Insecurity In The World" says the United Nations is worried about global "price volatility" - a euphemism for the prices of food items that soar while the incomes of the poor stay at ground level.

Food prices are no respecters of persons, especially the small. The worry of the UN is found in that 57-page (pdf) joint report of the Food & Agriculture Organization (FAO), International Fund for Agricultural Development (IFAD), and the World Food Programme (WFP) (fao.org). This Food Insecurity document by these UN agencies notes that "high and volatile food prices are likely to continue" (page 11), compounding the problem. To simplify, this is because of a conflict between food and fuel. The report says food demand will grow along with biofuel demand; while the population grows, so does the use of food items to produce biofuels.

Reading the manuscript, I have received an unintended revelation. As a global ISI-achieving Editor in Chief (Philippine Journal of Crop Science, 2001-2008), I note that the Food Insecurity report is well-informed, even erudite, and well-documented, as in fact it has a very long list of references. As an award-winning creative-writing alumnus (UP Los Baños, October 2011), I get the impression that the report is the product of a committee whose members did not agree 100% with each other. It happens to the best!

I mean, I find that there are actually 2 separate sets of major recommendations embedded in separate parts of the report, but neither refers to one or the other, and the 2 sets are neither mentioned nor integrated in the Executive Summary.

On page 4, the UN report says, "We also continue to highlight the importance of the twin track approach - improving both short-term access to food and food production in the medium term - in achieving long-lasting improvements in food security."

On page 42, the UN report says, "The challenge is to find cost-effective ways to reduce (food) waste and losses." This is after pointing out that 1.3 billion tonnes of food go down the drain every year all over the world. The report in fact points to the wasteful countries: "Most of the waste is in developed countries and most of the losses are in developing countries."

So, as I see it, the Food Insecurity report is actually recommending, as basis for government policies, 4 major steps towards long-term food security:

(1) improving access to food, for the hungry and starving
(2) producing more food, for the rest of us
(3) reducing food waste, in the First World
(4) minimizing food losses, in the Third World.

The Food Insecurity report doesn't mention it, but I will. Take the case of corn. Corn goes into food for humans and feeds for animals; today, corn is being used to produce bioethanol, and this literally eats on what the bipeds and quadrupeds eat - driving food and feed prices up. Driving the poor crazy.

That is why, for Africa and Asia, I'm worried for us and the poor farmers about food prices that are volatile, trending to stay up! But I'm more worried about the poor farmers' incomes that are stable, trending to stay down! Volatility is not a virtue in economics when you're up; neither is stability when you're down.

I will leave policies to the governments. I will leave access to food to the United Nations; I will leave reducing food waste to the United States; and I will leave minimizing food losses to the Asean in Asia and the United States of Africa in Africa. For the world’s poor farmers to produce more food, I will now go to India and visit the Patancheru campus of the International Crops Research Institute for the Semi-Arid Tropics (ICRISAT) because I have known for the last 5 years that ICRISAT is focused on the poor farmers of Africa and Asia.

For a little bit of history, my very first essay on the Institute was "The Yankee Dawdle. On Discovery Sorghum, The Great Climate Crop," 04 February 2007, American Chronicle). In that essay, I pointed out that the new & improved ICRISAT variety of sweet sorghum can "make richly productive the poor soils in the rainfall-challenged parts of much of the world, the millions of hectares of wastelands," where you will find the poorest of the poor. With sorghum technology from ICRISAT, Rusni Distillery in India is now producing bioethanol from sweet sorghum, decreasing pressure on corn for bioethanol.

Aside from sweet sorghum, ICRISAT has produced more new & improved varieties of chickpea, peanut, pearl millet, and pigeon pea that have proved to be not only high yielders but also disease- and drought-resistant.

But planting the better varieties guarantees only good yields even in bad soils; it does not guarantee that the poor farmers will rise from poverty, because while they are part of the value chain, they do not share the values added along the way, from production to consumption. The traders knock at the farm gate, pay what they may, and move on, leaving the farmers holding the empty bags with some cash at hand - that is all that they will get.

What if the farmers became their own middlemen? Good idea. Is that possible with poor farmers? Good question. ICRISAT Director General William Dar has a great answer: Producer Marketing Groups (PMGs).

Already, the PMGs in Kenya take care of production, distribution and marketing. They have so far managed to increase local producer prices up to 25% in Nairobi and Mombassa after linking with wholesalers. Thus, the collective actions of PMGs benefit poor farmers. "PMGs are owned and run by the farmers or jointly with private sector partners," William Dar says. The PMGs are an ICRISAT advocacy along with partners such as NGOs, government agencies, and other research institutes. ICRISAT and partners have been supporting PMGs in Kenya since 2003. (For more details, see my earlier essay, "New coffee in Kenya. In Emali, women show who's the better half," 26 February 2009, American Chronicle.)

Enlarging on the model of the PMGs, ICRISAT has come up with a strategy based on the concept of inclusive market-oriented development (IMOD) in its "ICRISAT Strategic Plan to 2020" (see my "ICRISAT's iMODe. The village as minimum development goal," 10 December 2010, American Chronicle). With the IMOD, ICRISAT and partners advocate and assist the poor farmers so that they gain control of the whole production-to-marketing process. They become their own suppliers of inputs, producers, traders, processors, and marketers - or have effective control of the entire value chain so that they get what they deserve of the value added along the chain. The poor farmers' income need to rise, if we follow Abraham Maslow's Hierarchy of Needs, beyond the Physiological (breathing, food, water, sex, sleep, homeostasis, excretion), up to at least the next, the Safety needs (security of body, employment, resources, morality, the family, health, property). And such income must sustain a minimum Safety lifestyle.

Given continuing Climate Change and food price shocks, the stability of the benefits accruing to all poor farmers all throughout the value chain is, to borrow from Shakespeare, a consummation devoutly to be wished.

ICRISAT means business. IMOD means value chain for the poor

2011-10-05T07:10:00.001+08:00

MANILA - How do you explain the success of ICRISAT in becoming the #1 institute within the CGIAR universe of 15 international centers for agricultural research? From where I sit, it's the positive & productive interaction of partners, people, science and funds - none more important than the other. It was Team ICRISAT at first, led by Director General William Dollente Dar, working with science, people and funds. Leadership made the local difference. Then it became Team ICRISAT & Partners. Partnership made the global difference.

In a chain, the strongest link is the weakest; in science, that's usually funds. In the 65th Governing Board meeting of the International Crops Research Institute for the Semi-Arid Tropics held at ICRISAT's campus in Patancheru, India held 21-24 September 2011, the GB approved the Institute's Fundraising Plan meant to set into full motion the Business Plan for 2011-2015, considering the revised funding processes and mechanisms of the mother agency Consultative Group on International Agricultural Research. You wait for the protocol, but you don't wait for the funds to come to you.

To raise even more funds, ICRISAT will pursue vigorously bilateral programs along with new partnerships to deliver science to more poor farmers in the drylands of Asia and Sub-Saharan Africa. Thus, for instance, the Institute is laying the groundwork for the implementation of the ICRISAT South-South Initiative, to enhance Indian-African partnerships on agricultural research for development. R4D or applied research is what ICRISAT does best. The IS-SI was launched during the last GB meeting in March.

Fund sourcing is an ICRISAT strength. In last month's meeting, the Governing Board applauded Team ICRISAT in efficaciously generating funds by packaging mega-projects such as TL II, HOPE and VDS.

TL II is Tropical Legumes II, a joint initiative of ICRISAT (handling chickpea, peanut and pigeon pea), the International Institute for Tropical Agriculture (cowpea & soybeans), and Centro Internacional Agricultura Tropical (common beans), along with national agricultural research systems in Sub-Saharan Africa and South Asia.

HOPE refers to the project Harnessing Opportunities for Productivity Enhancement of Sorghum and Millets also in Sub-Saharan Africa and South Asia. It hopes that within 10 years, the project will benefit around 2 million households in 10 countries in Africa and 4 states in India.

VDS refers to the project Village Dynamics Studies in South Asia. VDS gathers data & information on the consequences of change over time (5 years) within poor villages in South Asia (India and Bangladesh), to feed back to policymakers for appropriate Government action, and to other decision-makers in pursuit of more precisely targeted research for development. Without understanding the dynamics of change in those villages, decisions for policy changes and further research can only be guesswork, based on data that are fragmented, fuzzy and anecdotal.

I know all about anecdotal. It has power in itself. You tell the story of a poor Asian farmer who has grown Supercrop Z and in the last 5 years has accumulated savings in the bank to the amount of US$ 50,000. Very convincing. He followed all the technical instructions to the detail, followed every step, so he was successful. That's all you tell. You don't care if he was an extraordinary individual, if many other farmers failed doing exactly what he did, or why many farmers would or could not follow his footsteps despite the magnetic appeal of his obvious success. The power and danger of the anecdotal is dramatized by the fact that one media person who actively pursued and published the anecdotal for 15 years won an international award for journalism.

No, we cannot blame the awarding body. It wasn't the fault of the awardee either. Surprise! In the Philippines, blame the mass media-recognized value of anecdotal journalism on the UP College of Agriculture. I saw it with my own eyes when the Department of Agricultural Information & Communication of UPCA started writing and sending to Manila papers and broadcast stations those anecdotal stories in the early 1960s. UPCA made the anecdotal look smart, complete and commendable.

Isolated, independent, anecdotal stories mostly fail to tell of any partnerships that have helped bring about an individual farmer's success. Not only that. Truth to tell, the anecdotal stories from Philippine agriculture are those of farmers who were above the poverty line from the beginning.

One of ICRISAT's legacies even now points out that journalists and development workers cannot ignore partnerships. ICRISAT partnership is very broad and involves 6 Ps: people, people's organizations, private companies, political institutions, philanthropists, and patrons. Partnerships should be embraced by journalists; why, already the list assures them at least 6 angles for 1 story!

Why should the poor people themselves, the targets of science, be treated as partners? They have to be because they have to contribute to the development process; they have to contribute their share working out for their own benefit. Mendicancy is anathema to poverty alleviation. With mendicancy, the poor we will always have with us.

Even the poor must realize that they belong to a community whose members must help each other. For that matter, I think that I can explain the remarkable success of ICRISAT & partners by the workable formula of community:

(1) The Adarsha watershed success story is that of villagers who resuscitated a watershed and in so doing, revitalized their own community. ICRISAT & partners brought the science in, but change essentially began when the villagers realized the common need for them to change.

(2) The Agri-Science Park of ICRISAT at its campus in Patancheru is a community of businesses being incubated and the facilities and services necessary to transform ideas into commercial products. Thus, from the ASP has emerged several technologies and enterprises such as the use of sweet sorghum for ethanol production, Bt cotton, groundnut varieties such as Nyanda (released in Zimbabwe), new chickpea varieties released in India, and organic farming.

(3) The village diffusion of innovation (my term) by ICRISAT does not just help the early adoptors of technology following the Rogers model; it has reinvented the technology adoption lifecycle initially developed by Joe M Bohlen, George M Beal and Everett M Rogers and later adapted by Rogers for use in technology diffusion (Wikipedia). Thus, ICRISAT disseminates the technology to all farmers, whole villages. Model villages are more relevant than model farmers.

(4) The inclusive market-oriented development strategy of ICRISAT & partners is a virtual community of input providers, producers, traders, processors and marketers (see my "ICRISAT's iMODe. The village as minimum development goal," 10 December 2010, iCRiSAT Watch, blogspot.com). IMOD is aimed at insuring that the poor producers are actively involved and receive their proper share of the paybacks all along the value chain. Economists thrive on theory; poor farmers thrive on actual values added to their daily lives.

Overall, the challenge now is for ICRISAT to multiply the effects of the community of partners, people, science and funds by including more of the poor villagers that count in the hundreds of millions in the drylands of many countries in Asia and Africa. Now that it is mature, "Science with a human face" must be visited on villages upon villages of millions of people who most need it, who must realize that change begins with them.

The ICRISAT Decade. 10 years of “Science with a human face”

2011-09-30T11:54:00.001+08:00

MANILA - ICRISAT is a modern science phenomenon and it's time someone wrote the whole story of how leadership by Director General William Dollente Dar and followership by Team ICRISAT and partners in the last decade had made possible the unprecedented institutional success of the International Crops Research Institute for the Semi-Arid Tropics based in India. I shall refer to that period as The ICRISAT Decade.

The obvious starting point for any broader, deeper and longer exploration into the ICRISAT past is the annual reports. Now then, if you visit the ICRISAT website (icrisat.org) for this purpose, you will note that the available yearly publications start at 2001 and not at 1972, the year it was established by the Consultative Group on International Agricultural Research (CGIAR), which is supported by the World Bank and the United Nations. I think this means that it was only sometime in 2001 when ICRISAT earnestly began its in-house data & info management by electronic means; that is to say, 2001 was the year ICRISAT became formally & functionally computer literate.

It was 2000 when Dar first assumed the role of head of ICRISAT. Before this, the Institute had been underperforming for years and was in search of a new leadership with a new vision to reinvigorate the staff especially at the main headquarters in Patancheru, India. From then on, ICRISAT literally rose from the lowest rung to the top within a decade. It showed that, after all, ICRISAT needed only a drop of fertilizer from a bottle cap to grow into a robust, well-rooted fast-growing species in a dryland soil!

Now then, going over the annual reports of ICRISAT as well as turning over in my mind the data and information I have read and considered in writing all those 150-plus essays of 1,000 words plus on the Institute since 04 February 2007 - for all those, see my dedicated blog iCRiSAT Watch, blogspot.com - very roughly, I can divide the story of the management of ICRISAT under William Dar from the year 2000 to the year 2010, with 2011 in perspective, into 7 stages:

(1) Taking Stock in 2000
(2) Taking Command in 2001
(3) Taking Control in 2002
(4) Taking the Lead in 2003
(5) Taking Partners in 2004-2009
(6) Taking in the View in 2010
(7) Taking the Full Challenge of Poverty in 2011 and Beyond

In a separate study that I have earlier began, from what I have learned so far about the theory and practice of management of the Philippine Rice Research Institute (PhilRice) - so far as told in my 12 essays so far in a continuing series in my other dedicated blog The PhilRice (Insight) Story, blogspot.com - management is all about "taking action" - because you cannot go from here to there unless as the manager you act and not simply react. Management is the process, not the result. If you manage the action, you manage the result.

And no, the best managers in the world neither studied management in school nor in books - they acted on instinct and learned from experience, their own and that of others. That's what we have with William Dar.

Very briefly then, The ICRISAT Decade can be described as follows:

Taking Stock in 2000

This was the year of transition. This was essentially spent in putting back the pieces of ICRISAT together so that it can function as one organic whole.

For the year 2000, no annual report is available electronically; it tells me that under Dar's new leadership, ICRISAT spent the whole year examining and re-examining itself from the inside out but had not arrived at a stage where it could publish an annual report electronically.

In any case, this year the formal talks of the Director General were collected into a book, Bringing Science With A Human Face To The Semi-Arid Tropics, which tells us that the eye-opening mantra "Science with a human face" was assumed at the very start of Dar's headship.

Taking Command in 2001

On the 2nd year of Dar's command, the broader goal of "Science with a human face" gave birth to the more specific objective of "Grey to Green Revolution." ICRISAT was in the semi-arid tropics, and everywhere you looked it was grey (gray), referring to the soil that lacked not only fertility but more so water.

ICRISAT needed to be reinvigorated, and how more to reignite the fervor of the staff than to challenge them to turn the fields from unproductive soils to fertile, from colorless to green?

Taking Control in 2002

This year, Team ICRISAT saw that its research-for-development (R4D) projects must not only be productive but have impact on the local community. Outstanding R4D results do not have impact unless they are relevant to the community. Where local projects would succeed, the next logical progression would be to find how the R4D successes would impact other countries than the one which a specific R4D project had initially succeeded.

Taking the Lead in 2003

The objective was to build a stronger ICRISAT, so the Institute was subjected to 2 external reviews, the (a) External Program Review and (b) External Management Review, both of which it passed with flying colors.

Note that ICRISAT is under the aegis of the CGIAR. Interestingly, during the year, there was the CGIAR proposal to move the headquarters of the Institute from India to a country in Sub-Saharan Africa. The main reason given was that "the biggest challenge the CGIAR will face over the next 30 years will be in Africa" (CGIAR Report, World Bank, 03 October 2003). The idea was, "To be where the action is." That the move did not prosper may indicate that enough people realized that good research for development ignores social boundaries, knows no territorial limits, and is not location-specific. ICRISAT needed only to reengineer itself and then reach out to the world.

Taking Partners in 2004-2009

Having prepared a rich soil in the previous 4 years, in 2004 Team ICRISAT began earnestly sowing more seeds, germinating them, nurturing them, caring for them until maturity. Changing metaphors, on the way to discovering new horizons, innovations for a changing world, ICRISAT discovered the values added by what I shall refer to here as Science & the 5-P Partnerships with public officials, people organizations, private investors, philanthropists, and the people themselves.

It was also time to reorient the science of ICRISAT to the demands of a changing world, including food security, and to diversify the farm so that each crop is a hedge against the failure of the other, especially given the reality of Climate Change.

Taking in the View in 2010

Last year, Team ICRISAT formally adopted and declared a new strategy it called Inclusive Market-Oriented Development (IMOD). In my view, IMOD is the smartest undeclared revolution in research for development involving the poor farmers in the drylands. IMOD requires that full partnership support be given to farmers and their families, including directly connecting the farm gates to the consumers' doors, with the producers sharing optimally in the values added along the local and international marketing channels.

Taking the Full Challenge of Poverty in 2011 and Beyond

"For us at ICRISAT," says William Dar, referring to the data of absolute & widespread poverty as well as child malnourishment in the region, "they are reminders about our vision and mission in the dryland tropics, as well as our commitment to face the challenge of creating conditions that will allow those who are poor today to escape poverty." Thus the ICRISAT Strategic Plan to 2020, which is aimed at "empowering smallholder farm families and building their resilience on the path to prosperity." It comes with a Business Plan to make it work. Science with a human face means business.

The Next ICRISAT Decade has begun.

Challenge to Asian science media. How Mohamed can move mountains!

2011-09-19T06:31:00.001+08:00

MANILA - This morning, 17 September 2011, looking at the collection of press releases of the International Crops Research Institute for the Semi-Arid Tropics (ICRISAT) over the years to 2000, at its website (icrisat.org), I had a Eureka moment. An insight occurred to me in the field of science communication; to introduce it, I want to share it in the form of a well-known adage: "If the Mountain would not come to Mohamed, Mohamed must go to the Mountain." That's shallow in words but deep in meaning. In any case, if you read on, I will show you how to make the Mountain go to Mohamed!

The Science Institute is the Mountain; the individual journalist is Mohamed - if Science cannot talk the Language of the Prophet, the Prophet must learn to talk the Language of Science in order for the Prophet to be able to Translate and Talk Plainly in order to Proselytize the People. It would be science with a human voice.

My insight is in the form of what I shall call here The New IT, the new information translated, that is to say, knowledge transformed from technical to popular. Mastering and using The Old IT, information technology, The New IT should be simple enough to accomplish.

Since it is not the duty of the Mountain to translate Knowledge for the Man in the Valley, The New IT becomes the duty of Mohamed, that is, the journalist, the science communicator.

Now then, for Asian science, since The New IT cannot be undertaken by a single individual no matter how willing and intelligent and resourceful, I'm challenging media groups to embark on a common project to popularize science and science-based opportunities in the Asian marketplace:

Agriculture Today (AT) (agriculturetoday.in)
Asian College of Journalism (ACJ) (asianmedia.org)
Asian Institute of Journalism and Communication (AIJC) (aijc.com.ph)
Asian Journal of Communication (AJC) (tandf.co.uk)
Asian Media Access (AMA) (amamedia.org)
Asian Media Information and Communication Centre (AMIC) (amic.org.sg)
Association Of Asian Communicators (AAC) (ufl.edu)
Biz Asia (media247.co.uk/bizasia)
Channel News Asia (CNA) (channelnewsasia.com)
Institute of Communication for Life (ICL) (lifecommunication.org)
Pacific & Asian Communication Association (PACA) (paca4u.com)

As this Mohamed sees it, the ultimate objective of The New IT project is to generate for the applied sciences a people's database of

technical terms with their technical definitions
technical definitions with plain English explanations & many examples in use
technical terms expressed as figures of speech (such as metaphor, simile, hyperbole, personification, parallelism, understatement, synecdoche), especially useful for difficult-to-understand concepts such as "holism" and "food security" and "climate change"

and, I must add, with the database accessible through a website via computers and mobiles (PCs and phones).

One other important thing: the keywords or search words for The New IT database are also to be in plain English. (For the technical minded, they can always use the scientific terms they already or should know.) It will be an online dictionary of science for communicators. It will be like heaven, like they don't have to know any technical term to search for information.

It will probably be a 2-year project but comparatively inexpensive, as it can proceed mostly via electronic communication. I can contribute sitting in front of my old Core i7 desktop computer at home or my new Lenovo S100 netbook out there.

From The New IT, books may be written, manuals generated, and online courses developed. In plain English, finally, the Mountain goes to Mohamed, and the Prophet goes to the People!

I'm sure the International Crops Research Institute for the Semi-Arid Tropics (ICRISAT) under Director General William Dar will be very willing to be a partner in this giant endeavor. If nothing else, partnerships are what ICRISAT is known for. This reputation has been hard-earned starting in the year 2000 when Dar became Team Captain of ICRISAT.

Like I said, the insight came to me while I was thinking of press releases. To us journalists, each press release is a much-valued "key informant" or "knowledgeable source" or "unimpeachable source" or "source close to the top" or at the very least is a "waker-upper."

Looking over the press releases (PRs) of ICRISAT within the last 6 years, from 2006, a total of 146 PRs so far, I find that the press release (PR) as a tool for public relations (also PR) is a resource that the Institute needs to explore much, much more. I mean, with an International Institute like ICRISAT, I expected to be overwhelmed with press releases at its website. What happened was that I was underwhelmed. That goes with the other of the 15 centers of the Consultative Group on International Agricultural Research (CGIAR).

For the CGIAR more than any other science group, the way I see it, if the PR is a resource, then it should be more than a press release or for public relations, or cultivating goodwill; it should be for public consumption (PC), or cultivating users of knowledge. Then the PR as PC will grow more than goodwill. The reading public is always asking: "What's in it for me?"

I suggest a ready-made framework for press releases: The Rotary 4-Way Test, which runs this way:

1. Is it the TRUTH?
2. Is it FAIR to all concerned?
3. Will it build GOODWILL and BETTER FRIENDSHIPS?
4. Will it be BENEFICIAL to all concerned?

Here's the ICRISAT data of press releases across the years: 17 PRs for 2011 so far, 19 PRs for 2010, 28 PRs for 2009, 29 PRs for 2008, 27 PRs for 2007, and 25 PRs for 2006. I stopped at 2006 because that was the year I began writing on the drylands science of ICRISAT. 2006 is also doubly significant. While I began writing on ICRISAT, at the same time 2006 was the year when the President of India, APJ Abdul Kalam signed with my President Gloria Macapagal-Arroyo a memorandum of understanding (MoU) for cooperation in agriculture and related fields. I can't resist the parallelism: Here was a citizen of the Philippines (that would be me) helping propagate some seeds of science generated by an India-based institute; here was the India-based institute helping the Philippines propagate some seeds of hope in the form of new, improved varieties of peanut and sweet sorghum.

The maximum of 29 PRs for 1 year comes to an average of 1 PR every 2 weeks. That is to say, Team ICRISAT talks only every other week. I think Team ICRISAT can do much better than that!

I understand. The problem is that the technical stuff is difficult even for the technical staff to translate into the popular, to transform the scientific into plain English. For instance, in the 3rd press release for 2006 that dealt with the India-Philippines MoU, among the 573 words, these 9 hard-to-digest terms were used without explanation or example:

commercially viable
low input
partnership-based research
adaptability and agronomic performance
research products
additional requirement for ethanol
tillage practices
nutrition management
dryland cultivation.

Yes, it's a problem for communicators, not scientists; it's a problem for translators, not technical experts. It's a problem for Mohamed, not the Mountain, but it can only be solved if Mohamed moves the Mountain.

In the language of Marshall McLuhan, the message must massage the reader. Knowledge must attract his attention, not distract him. The language must move the reader to action, not immobilize him.

That is why modern science communication needs The New IT. For science to serve the people, the new information in translation is the call of the hour all the time. It's time Mohamed moved the Mountain!

Small Is Bountiful. Grains of HOPE, Gains of IMOD

2011-08-31T14:10:00.001+08:00

MANILA - Appreciation comes in small packets of seeds, this the International Crops Research Institute for the Semi-Arid Tropics (ICRISAT) had utilized in 2009 yet, as reported by William Dar, Director General of ICRISAT (see the full text of his remarks in "Pea and Sympathy," 23 November 2009, iCRiSAT Watch, blogspot.com). You don't have to go to the drylands of Africa and Asia to appreciate the big value of small packets of good seeds which now, along with the soil is the most visible starting point for good agriculture anywhere, but especially dramatized in the drought and hunger now aggravating the Horn of Africa (see my "Science for Africa! From ICRISAT & Partners: Knowledge only if you take it," 22 August 2011, iCRiSAT Watch, blogspot.com). The Promise: From small packets come big surprises.

When it comes to soil, no matter what kind, as much as it cannot store green water, the soil is as much a failure (see my "Green Agriculture. 2 words to simplify farming & gardening," 17 August 2011, Genesis Agriculture, blogspot.com). When it comes to seeds, technically, you can view the failure of agriculture in any or all of 4 ways:

1) Climate Change, the latest & easiest scapegoat - This is the one that on one hand brings the drought and on the other the flashfloods. If you're not paying attention, your good seeds become bad, as they are not climate-change ready.

2) Farmers' lack of demand for good seeds - There are good seeds but the farmers can't see the economic opportunities. This is because of economists who don't understand the economics of the small, where if you do it right, small is bountiful. And because of the communicators who fail to convince farmers to appreciate the value of good seeds, assuming they themselves do.

3) Experts' failure to understand farmers' needs - The poor farmers need more than good seeds. Like, they need to survive this week and the next.

4) Experts' failure to see beyond farmers' needs - Like, the poor farmers cannot articulate for themselves their desire to enjoy the fruits of their labor aside from food and what they get at the farm gate.

Paying attention to all those concerns, ICRISAT & Partners from civil society, business and government have come up with the Project called HOPE and a modus operandi called IMOD. HOPE is Harnessing Opportunities for Productive Enhancement of Sorghum and Millets in Sub-Saharan Africa and South Asia (see also my "HOPE for farmers in Africa and Asia," 23 November 2009, iCRiSAT Watch, blogspot.com). IMOD is Inclusive Market-Oriented Development for the villages (see also my "An African Revolution. IMOD Power to the Women!" 22 September 2010, iCRiSAT Watch). Supported by the Bill & Melinda Gates Foundation, HOPE was launched in 2009, a 4-year project. Supported by partners, the ICRISAT IMOD was formally adopted in 2010, a continuing project. This time, I would like to link them together.

Project HOPE brings in the good seeds; the work ethic IMOD brings in the good mode of operation, as we shall see. Better seeds of sorghum, pearl millet and finger millet are brought by Project HOPE into 10 countries in Sub-Saharan Africa and 4 states in India. Growing those seeds, with IMOD in place, the farmers are sure to get back big their little money's worth by actively participating in the whole development process, from producing the good seeds and growing them, up to and including marketing locally and abroad. Before IMOD, the farmer's road to prosperity has always ended at the farm gate.

You start with good seeds and good soil, and you stop there. That's what happened in Green Revolution Version 1.0: Miracle seeds and soil made miraculously productive by chemical fertilizers. Green Revolution 1.0 enriched the banks, other moneylenders, chemical companies, traders, well-to-do farmers, but it left out the poor farmers.

What we need today in the drylands of Africa and Asia is Green Revolution Version 2.0, a Double Revolution, where villages are taught to produce their own good seeds assisted by science, civil society, business and government in their own adaptation of Project HOPE, and at the same time these same villages harvest not only the grains but also the gains in the markets of their produce assisted by their own IMOD. Then from small packets will come big surprises.

In Mozambique, ICRISAT & Partners are evaluating new crop varieties of pigeon pea that are high-yielding and preferred by the target markets (icrisat.org). If you're raising a crop that the market does not prefer, you're only raising your own failure.

In Malawi, instead of giving out free seeds, in a common project, Ireland, ICRISAT and other partners are "supporting local entrepreneurs in seed production and marketing of crops" such as peanut and pigeon pea, both of which have ready markets in Malawi and overseas (icrisat.org). Free seeds only encourage mendicancy.

In India, ICRISAT partnered with the Indian Council for Agricultural Research and state agricultural universities to develop short-duration chickpea varieties that yield high and resist the deadly disease called Fusarium wilt. The new chickpea varieties include JG 11, KAK 2, JAKI 9218 and Vithar; they now cover 90%+ of the chickpea croplands in Andhra Pradesh, the home of ICRISAT. Thus, in this state, there has been a remarkable rise in yields of chickpea, from 583 kg/ha to 1,400 kg/ha from the year 2000 to 2010 (ICRISAT Annual Report 2010). Andhra Pradesh was once considered unfavorable for the crop; today, the state has the highest yields in chickpea in all of India. What is more incredible, total chickpea production in Andhra Pradesh is now near the combined total production of Australia, Mexico, Myanmar and Canada. With great contribution of produce by Andhra Pradesh, for the first time in 30 years, India became a net exporter of chickpea in 2007 yet.

Indian farmers benefitting the most from chickpea are visibly those in the Kurmool District; with chickpea income, they are now financing their own dairy farming. As a result, these farmers have acquired TV sets, motorcycles, tractors and threshers. They also now live in brick houses, where before they lived in mud abodes. Education is a priority. For instance, Narayana Reddy is educating his grandchildren in a residential school. And savings are now a phenomenon and welcome, like some farmers have in their bank savings about $4,500 a year.

In summary, William Dar says:

There has been a transformation from subsistence to market-oriented cultivation for chickpea in Andhra Pradesh, which provides an excellent example of IMOD. The success story of chickpea in Andhra Pradesh is proof positive that adoption of technologies with adequate support systems can enhance production of chickpea in other regions of South Asia and Sub-Saharan Africa.

Back in Africa, ICRISAT Project HOPE partners include Alliance for Green Revolution in Africa (AGRA), the International Sorghum and Millet Improvement Programme, Africa Harvest, West Africa Seed Alliance, Institute d’ Economie Rurale in Mali, and USAID. AGRA is coordinating with African governments "to assemble the critical mass of resources to realize the agricultural potential" of the breadbaskets of Africa, those "areas of relatively good soil, rainfall, infrastructure, and large numbers of smallholder farmers" (agra-alliance.org). Led by Kofi Annan, former Secretary-General of the United Nations, AGRA must be doing great.

Meanwhile, other areas in Africa and Asia must be doing poorly, if not badly. That is where we, with ICRISAT & Partners, should find more Project HOPE incursions and greater IMOD intrusions. In the drylands of the poor, Green Revolution 2.0 must go on.

From small packets must come big surprises, so that the poor we shall not always have with us, to show the world that Small Is Bountiful.

Climate Change & The Poor: We shall not always have with us - ICRISAT

2011-08-28T18:25:00.001+08:00

ICRISAT INDIA - Sufficiently alarmed at what has been happening in India in the last 30 years such as the Nalgonda District of the State of Andhra Pradesh turning from semi-arid to arid - where arid indicates severe lack of available water (Wikipedia), they held a meeting on 16 August 2011 at the Patancheru campus of the International Crops Research Institute for the Semi-Arid Tropics (ICRISAT). They called it the "Round Table On Climate Change And Rainfed Farming Systems" and ICRISAT Director General William Dar delivered the Inaugural Address, "Building Climate-Resilient Rainfed Agriculture Through Sustainable Adaptation Measures." To appreciate the magnitude, know that in Africa, according to ICRISAT, the drylands cover about 40% of the arable landmass. We have to adapt, now; Climate Change waits for no one. Especially in the drylands.

A round table is a meeting of peers for discussion and exchange of views (WordNet 3.0, thefreedictionary.com). Remember King Arthur and his Knights of the Round Table? Legend has it that he ordered the carpentry work so that at the table where he and the knights congregated, everyone was the equal of everybody else, king included. That was in England, in ancient times.

In modern times, the way I understand it, at Patancheru, it was a roundtable (also correct) because no one had the right answers, or the answers needed the contribution of everyone, such as from the research bodies of India, the universities, corporations, and government. Agriculture is not simple; it is not merely the cultivation of the soil; it is moreover the cultivation of whole villages. It takes a village.

To avoid confusion, I'm using the term drylands interchangeably with the terms rainfeds and rainfed areas, those cultivated lands that depend solely on rain to grow the crops; thus, rainfed agriculture is the same as drylands agriculture. The terms denote the problematic lack of water for farming.

As Dar welcomed the guests, he said something I didn't know before: "Welcome to ICRISAT, the only international center in the semi-arid tropics working towards improving the livelihood of millions of small and marginal dryland farmers." I think he was implying: If ICRISAT is going to help more people, it needs more help from more people like you.

ICRISAT has been carrying out its mandate, and beyond that, for the last 40 years. But the task is not easy, as it involves millions of poor farmers. It needs the cooperation of everyone, including the farmers themselves; progress cannot proceed without everyone's consent and contribution. Everyone must be an actor and at the same time a producer.

Palpable Climate Change has added to the urgency. Aside from Nalgonda, there is the Pharbani District in the State of Maharashtra, ICRISAT tells us, where because of extreme heat, sorghum may no longer grow after the rains within 10-15 years. A good friend of mine, Sam Martin, has just returned from his native India and he said the heat in the Philippines was nothing compared to India, and it wasn't that hot before. If you still don't believe in Climate Change, I know you have not gotten out of your comfort box.

The roundtable discussions centered on adaptation and mitigation approaches based on science to protect the lives and livelihoods of the poor farmers who lived in the rainfeds. As much as possible adapt to the realities, mitigate the damages. Why the focus on the poor? "Climate Change will have far-reaching consequences for agriculture," Dar said, "that will disproportionately affect poor and marginalized groups who depend on the sector for their livelihoods and have a lower capacity to adapt." Dar is saying the adverse effects of Climate Change will be felt first in the drylands, and that is where the poor farmers live. If we do nothing, the little that the poor have will be taken away from them - not by God but by Climate Change, believe me.

65 scientists from Indian and international research institutions, government, civil society and business came to the roundtable meeting organized by ICRISAT along with the Jindal Steel Works-Times of India Earth Care Initiatives 2011. JSW has a separate division for Corporate Sustainability; that goes well with Corporate Responsibility. You have to put your money where your mouth is.

We are told that the better-known panelists during the meeting included AK Singh, Deputy Director General of the Indian Council of Agricultural Research; PK Joshi, Senior Program Manager of the International Food Policy Research Institute; B Venkateswarlu, Director of the Central Research Institute for Dryland Agriculture of India; Sachin Oza, Executive Director, Development Support Center; SB Dandin, Vice Chancellor of the University of Horticulture; JK Tandon, CEO, Corporate Sustainability, Jindal Steel Works (JSW); Biswanath Sinha, Sir Dorabji Tata Trust; Gopichandran Ramachandran, Gujarat Energy Research & Management Institute; and Mukund Gorakshkar of JSW. The poor in the drylands are known as a matter of common concern.

The drylands are "the hot spots of poverty and are also the most vulnerable to the impacts of Climate Change," Dar said. "Rainfed agriculture is the life line for most small and marginal farmers." So today, you have a doubly urgent reason to help the poor farmers in the rainfeds: Because the poor are tired being poor, and because Climate Change threatens to make them poorer still.

"We believe that to reduce the vulnerability of the smallholder farmers to climate change," Dar said, "we must create a sustainable, inclusive, resilient, profitable and healthy agricultural sector." Sector. If you want to help the individual farmers, you must help them all. You cannot help a family if you do not help the village. It takes a village. And another village, and another village.

Meanwhile, the Asian Development Bank (ADB) is funding an ICRISAT study, "Vulnerability to Climate Change: Adaptation strategies and layers of resilience." The study targets the poor farmers of drylands Asia, especially those in Bangladesh, India, Pakistan, Sri Lanka, Peoples' Republic of China, Thailand and Vietnam. I say, it should answer some questions like: "With assistance but not dependence, given location-specific conditions, what can the poor villages do in the face of a Climate Change event? What can't they do? What can government do? What can't it do? What can scientists do? What can't they do? What can partners do? What can't they do?"

ICRISAT works with its Hypothesis of Hope. "This hypothesis clearly indicates that we can bridge the gap between the farmers’ yield and achievable potential yield to ensure improved food production and livelihoods for the farmers," Dar said. Frank H has written about ICRISAT's Hypothesis of Hope - see my "Servant-Leader William Dar. Can't follow, can't lead," 10 October 2009, iCRiSAT Watch, blogspot.com; it is essentially computer modeling of crops, weather and soils, to predict the impacts of Climate Change on crops, for more scientists to be able to help more farmers. With such science, working in partnerships with others such as development workers and policymakers, Dar said, the Hope is that with much increased yield and much improved modules of assistance, in the face of Climate Change, not only will the farmers be able to produce their own food but also improve their own level of their living.

And show the world the Hypothesis of Hope proving itself in Village Vigor. Especially in the drylands.

Science for Africa! From ICRISAT & Partners: Knowledge only if you take it

2011-08-22T05:43:00.001+08:00

MANILA - Learning of the drought and famine in the Horn of Africa, I'm thinking like, "Is computer simulation yet backward that it could not have predicted a year before the twin disasters that are plaguing 12 million in the Land of the Berbers?"

But in fact, the Famine Early Warning System Network (FEWSNet) that the USAID set up in the 1980s "provided an alert of a potential crisis in the summer of 2010" yet (usaid.gov). What happened with the FEWSNet alert? Nothing, that's why we have a bigger problem now. Knowledge is power; prediction is knowledge only if you take it.

The Action Congress of Nigeria (ACN) criticizes the Federal Government "for not leading efforts to alleviate the sufferings of millions of Africans who are victims of drought and famine in the Horn of Africa" (Nneka Nwaneri, 19 August 2011, thenationonlineng.net). "Waiting for the belated Pledging Conference being organized by the AU (African Union) next week," says ACN's National Publicity Secretary Alhaji Lai Mohammed, "before doing anything towards ending the humanitarian crisis in the Horn of Africa, is a disappointing lack of initiative on the part of the Jonathan administration." Initiative is yours only if you take it. It cannot be forced on you. Leadership is yours only if you take it. It cannot be thrust on you.

"The clock is ticking for East Africa," says Penny Lawrence, International Director for Oxfam, "and the African Union governments who are meeting next week must show their determination to make this Africa's last famine" (quoted by Ella Ide, google.com). Alas, the last it will not be. Famines occur in non-democracies, not in democracies, according to Indian Nobel Prize awardee Amartya Sen (Michael Massing, sandiego.edu). Democracy is knowledge and it's yours only if you take it. Should it be given to you? No, not really; that's a contradiction. You have to take it yourself.
Cristina Amaral, FAO's head of emergency operations, says "the most urgent tasks (are) to prepare farmers for the October rainy season and widen humanitarian access in southern Somalia" (Ide as cited). Farming must go on. Good food production is knowledge and it's yours only if you take it.

Should such knowledge be given to you? Yes, but the starvation must go first. Then, it must be a long-term goal. And when you're ready, tap the knowledge bank of ICRISAT and partners; it's ready.

On 09 August 2011, ICRISAT released what it called a Media Factsheet entitled, "Science-Based and Sustainable Solutions to the Drought and Famine in the Horn of Africa," a Microsoft Word 1997-2003 document in 8 pages with photographs. For some reason, I ignored it. Then on 11 August 2011, ICRISAT came out with another document, "Science-Based and Sustainable Approaches Towards Food Security in West and Central Africa," an Adobe pdf file, and this one I wrote about (see my "Drylands, Africa. ICRISAT & Partners - What can be done right, now!" iCRiSAT Watch, blogspot.com).

Sometimes, we ignore death and devastation around us, until we bump our head or something. Knowledge is power, but not when we ignore it. The Horn of Plenty can remain the Horn of Empty if the Horn rejects knowledge.

Now then, I cannot now ignore the fact that the earlier ICRISAT Media Factsheet about the Horn and the later modified version are peas in a pod with some major technical differences. For our purposes, those differences don't matter much - the two documents are one in offering science-based and sustainable approaches (to West and Central Africa) and solutions (to the Horn of Africa). The word "approaches" suggests medium- to long-term, while the world "solutions" suggests short-term actions. But in fact, the recommendations are the same, established by science, as they should be, except for the crops (see also my "Drylands Africa" that I mentioned above):

1. Growing drought-resistant, climate change-ready crops - sorghum, pearl millet and peanut (groundnut) for West and Central Africa; sorghum, pearl millet, pigeon pea, chickpea, and peanut for the Horn.

2. Reforming seed aid and seed policy - At the Horn, they can learn from Malawi and start with a revolving fund to sustain the growing and distribution of better seeds.

3. Institutionalizing incentives for the cultivation of dryland crops - The Horn can do it by searching and sustaining new markets for new produce from poor farmers who must directly benefit from those markets.

4. Assessing and managing climate risk - The Horn farmers should have access to up-to-the-minute weather events, as well as weekly, monthly and yearly emerging climate patterns - and they should be provided options for action.

5. Fertilizer microdosing - The Horn farmers should learn that a bottle cap of fertilizer is enough for a hill of a crop, dropped at planting time with the seed and again at 3-4 weeks after the seedling emerges.

6. Conserving soil and water and rehabilitating degraded lands - Africans can copy from Africans. For instance, the zai pit, a planting hole dug 20-40 cm wide and 10-20 cm deep to capture the rain when it comes. The zai pit was originated in Mali and improved in Burkina Faso.

7. Battling poisonous aflatoxin. For the Horn and other places, there is now an inexpensive test kit for aflatoxin in raw materials or food products made from peanut, corn, sorghum, pearl millet and others.

From the theory and practice of ICRISAT and partners, all that and more is knowledge - the Horn can take it or leave it!

Significantly, the Horn version of the ICRISAT media factsheet proposes in the long-term:

To prevent disasters like the one affecting the Horn of Africa, development investments for the dryland tropics must be significantly increased and sustained. Spearheaded by scientific innovations and propelled by strong public-private-civil society partnerships, improving dryland agriculture should form the cornerstone of making dryland communities resilient especially during emergencies.

ICRISAT is calling for more investments for the drylands, and to keep the investments coming - to generate newer science pushed by partnerships among government, business and civil society, to create the foundation for helping make the poor dryland villages rich and resilient.

With strengthened and sustained support, CGIAR and its partners could offer tested science-based innovations that should be widely pursued by national governments to help extricate vulnerable African communities from the drought-poverty trap for good.

In short, Science for Africa! ICRISAT is 1 of 15 institutional members of the Consultative Group on International Agricultural Research (CGIAR) based in Washington DC. Today, ICRISAT has the clout to speak for CGIAR in such terms, being the most innovative of the 15. May its tribe increase!

Drylands, Africa. ICRISAT & Partners - What can be done right, now!

2011-08-16T07:07:00.001+08:00

MANILA - Mostly through green-colored glasses, I, old Ilocano armchair farmer and new IdeaPad netbook-armed writer, am looking at the drylands of West and Central Africa, more than 5,000 km square in more than 18 countries. With official presence in that part of the world, we are told the International Crops Research Institute for the Semi-Arid Tropics (ICRISAT) under Director General William Dar has been looking here at the poorest of the poor, with more than 1/3 of the population earning less than a dollar a day - and malnourished. Been there, done that!

An official technical ICRISAT report was released 11 August 2011, "Science-Based and Sustainable Approaches Towards Food Security in West and Central Africa," where on the 3rd paragraph it states that "ICRISAT's top priority is to find ways to help extricate vulnerable dryland communities out of hunger and poverty for good." Very good. Very technical.

To help the poor become unpoor for the rest of their lives, here is what ICRISAT and partners are trying to say in the title of the report:

science-based, meaning supported by reason & the results of research;
sustainable, meaning can run true to form or sustain itself indefinitely;
food security, meaning there is no longer the threat of hunger;
vulnerable, meaning exposed, unprotected, helpless;
to help extricate, meaning ICRISAT cannot do it alone.

I notice that, really, I do not have any problem with the language, but I do have a problem because this time I notice that ICRISAT starts with the solution and not with the problem!

Not to worry. Really, ICRISAT has done its homework - I know because I've been writing about this Institute for the last 55 months, since February 2007, since I came to know personally William Dar, science manager par excellence.

But, as it turns out, "Science-Based and Sustainable Approaches" by an unknown author is both a lesson in solving poverty in Africa as well as a lesson in writing about poverty, period - and, if you ask me, the scientist is no more important than the writer. I should say, recalling and reinventing Marshall McLuhan: The messenger is the message. At the very least, the messenger is as important as the message. Most especially if the messenger is the scientist himself.

Right now, we can only get rid of the unknown messenger if we get to know his message. Now then, as I understand him or her, without sorting them out, from the 7-page pdf, I see there are 7 things that can be done right, right now:

1. Grow better crops.
2. Make better seed policies.
3. Support and sustain dryland farmers more.
4. Confront climate risk.
5. Use less fertilizers.
6. Conserve soil and water.
7. Get rid of the fungi.

With this report, ICRISAT and partners show us how to work with the drylands dust to dust, crop to crop:

1. Grow better crops.

Sorghum and pearl millet are the staple crops of more than 100 million in the drylands of West Central Africa (WCA). These crops eat up 70% of the farmlands; they make up 60% of all cereals produced; they contribute 75% of the calories and some 33% of the protein to the dryland Africans. "Yet, these crops are poorly traded in the national, regional and international markets," the report says. Meaning, the varieties planted are not what the consumers want - and nobody told the poor dryland farmers before!

So, ICRISAT and partner agencies have developed new, improved diverse varieties of pearl millet, sorghum, and peanut (groundnut) and some of these the farmers love and markets buy. I'll buy all that.

2. Make better seed policies.

During disasters and devastations, the poor farmers of Sub-Saharan Africa cannot plant because they have a problem with seeds: either they have none to spare for planting, or they can't afford to buy those. What can be done is to set up local certified-seed businesses.

A model for WCA can be drawn from Malawi where ICRISAT and partners have trained farmers to grow improved peanut varieties and the harvests are bought back via a revolving seed fund. After 6 years of this, the seed fund has proven its worth: there is a sustained supply of breeder seeds; there are large volumes of foundation seeds; and in fact there is fund to spend for the wide adoption of the better varieties throughout Malawi.

The Malawi experience has led to the adoption of the seed fund scheme in Mozambique, with government support. Likewise, the scheme is now being adopted in several other countries through the West Africa Seed Alliance (WASA). The business side of WASA and other seed alliances is what is needed to support local produce, provide seeds and related inputs, and optimize the benefits to local dryland farmers. One lesson here is that relief programs should not stop at ad hoc or stopgap interventions but instead turn themselves into powerful development tools to help the poor uplift themselves.

3. Support and sustain dryland farmers more.

In June 2011, the G20 countries acknowledged the need to set up strategic food reserves to meet future crises. The World Food Program has set up the Purchase for Progress Initiative (PPI) to buy local for food aid operations. ICRISAT and partners recognize that the PPI becomes a market that can be profitably tapped by dryland farmers. To target the PPI and other markets, the inclusive market-oriented development (IMOD) approach of ICRISAT and partners should be in place. Note that the IMOD approach calls for strong policy support from government and enough investments from business for dryland crops.

4. Confront climate risk.

For dryland farmers, there should be short-term climate and daily weather forecasting, medium-term predictions of rainfall variability, and long-term climate change implications on farming. The farmers have the right to know what's happening, and what they can do about it now. Meanwhile, computer models of ICRISAT indicate that given climate change, farmers can be productive with better crop varieties and improved farm management. For good agricultural practices, ask ICRISAT.

5. Use less fertilizers.

ICRISAT has found, surprisingly, that in much of Sub-Saharan African soils, lack of water is less of a problem than soil fertility. With that in mind, ICRISAT and partners have come up with a drop-cap solution they call microdosing: At planting time, you measure out your fertilizer on a bottle cap and drop it along with the seed; you can also microdose at 3-4 weeks after the seedlings have emerged. And microdosing works macro! It has increased sorghum and millet yields up to 120% and incomes by 50% on more than 200,000 households in Sub-Saharan Africa. Microdosing has contributed about 70,000 tons of additional grain, or about US$ 12 million, toward food security of poor farmers in that region.

6. Conserve soil and water.

ICRISAT and partners have come up with a farming strategy of concentrating water and fertilizer close to the plant roots. The techniques include the microdose and either of 2 or both types of planting basins: zai pit and demi-lune.

Zai pits: Originated in Mali and improved in Burkina Faso, each zai pit is a hole dug 20-40 cm wide and 10-20 cm deep (worldbank.org). At the bottom, the farmer puts in about 2 handfuls of organic material (animal manure or crop residue). Into each pit some rain must fall, and when it does, the planting starts: pearl millet or sorghum seeds go down there. The hole collects the rain; the organic matter rots - and both water and matter feed the plant with rich nutrients.

Demi-lunes. These are half-moon-shaped micro-catchments that collect run-off water and protect the soil from erosion (CPWF, padniger.net). These are also called D catchments, because of the shape (Kim Arth, peacecorps.gov). The United Nations Environment Programme calls them "semi-circular hoops" and says they vary in size from 2 to 15 meters (unep.org.jp).

7. Get rid of the fungi.

Aflatoxin, the poisonous substance from the fungi Aspergillus flavus and Aspergillus parasiticus, contaminate food products from peanut, corn, sorghum, pearl millet, chilies, pistachios, cassava and others. More than 5 billion people in the Third World are constantly exposed to aflatoxins in contaminated foods. Many countries reject imports of farm produce found to exceed certain levels of aflatoxin, which cost farmers millions of dollars in lost sales. If you can't get rid of the fungi, get rid of the toxin. ICRISAT has devised a fast, simple and low-cost ELISA test for detecting aflatoxin, and this has revived the moribund peanut industry in Sub-Saharan Africa by opening the European export market. New markets, new hopes.

After counting 7, I'm thinking of the drylands of the Philippines and the work that the Department of Agriculture through Secretary Proceso Alcala has to do to help the farmers, and the toil that farmers have to do to help themselves. How many times do we have to help the farmers help themselves? 7 times 7 times.

Drylands Yes, Rain-fed No. PhP 20 M from DA and you’re all wet!

2011-08-11T00:52:00.001+08:00

SAN MIGUEL, BURGOS – Say “rainfed” or “rain-fed” and you’ve stated the problem.

Say "International Crops Research Institute for the Semi-Arid Tropics" or "ICRISAT" and you've stated the solution.

The water's the problem. Where’s the water? Down there (I took the photo 10 July 2010). Rainfed is the problem of the 3 owners of these ricelands I’m visiting, 7 hectares contiguous to each other. Along their common heads runs a huge irrigation canal coming from Magat Dam in the nearby town of Ramon. Magat is one of the largest dams in the Philippines and you know what? It’s one of the biggest dam failures!

And I can prove it. These 7 hectares are enough proof - this irrigation canal is empty of water most of the time. Even when it's full of water, and therefore of service, as this image suggests, it's so damned deep you can drown twice in the same vertical dive.

Am I exaggerating? Not much. When there's water in the canal, you have to pump it; and then, when the rains go away, the water in that canal goes with them.

At the Adarsha watershed at the village of Kothapally in India, when the rains go away, enough of the rains stay as green water in the soil and as blue water underground. There is enough water for the homes, the crops and livestock. We can thank the villagers - and the International Crops Research Institute for the Semi-Arid Tropics (ICRISAT) based in India and her partners in research for development (R4D) for showing us how. Adarsha is now a model R4D project for Asian countries.

That's the good news. Sad to say, in the Philippines, the way we communicate the good news to the farmers is bad. We are delivering the message with too much noise the message is garbled.

With Adarsha in mind to emulate, in Manila, R4D is the intention of the Department of Agriculture (DA) in releasing an initial PhP 20 million to finance a new farmers R4D package. Funds are always welcome; what I don't welcome is the fact that the program has been given a name that even an agriculturist like me finds difficult to digest: PhiRARDEP, for Philippine Rainfed Agriculture Research and Development and Extension Program; it's "rainfed" says Rita Dela Cruz (April 2011, bar.gov.ph); it's "rain-fed" says James Konstantin Galvez (28 July 2011, manilatimes.net). Actually, the word with or without hyphen is correct - but it's wrongly used in/by mass media: print, radio, TV, the Internet.

It's not understood. Name me a government official who understands when you say "rainfed" - Senator, Congressman, Cabinet Secretary, Director - you can count on the fingers of one hand. And you need all their advocacy! On one hand, the media people have not bothered to ask the scientists what they mean by "rainfed" so they can talk about it intelligently. To imply that the "rainfed" lands are the "uplands" is misleading. On the other hand, the scientists have not bothered to explain. It's plain to see the scientists and media are not communicating with each other.

Research for development is important; communication for development (C4D) is equally important, if not more so. "Rainfed" or "rain-fed" is an unfortunate choice of word. One, literally, the term rainfed means the farm or field relies on the rain to feed water to the hungry crops. Rainfed means irrigation water is not available, or too expensive, as in San Miguel, Burgos in Isabela. Two, the term cultivates the mental habit that the soil cannot be productive (a) if without irrigation water and/or (b) if without the rain. If you think all that, you're all wet!

Instead of the word rainfed, the term drylands is better because everybody knows what it means. Why do the scientists - and the media after them - insist on language that only they can understand?

With a Filipino Director General named William Dar, ICRISAT hardly ever say "rainfed" and always say "drylands" because that's the best way to describe them. Also, it sounds like "badlands," which they are if you don't understand them.

So, the PhiRARDEP people are starting on the right path but stepping with the wrong foot - the public and the farmers don't understand them. C4D, they have to see for themselves. So, learning from the ICRISAT people, from now on I'll call PhiRARDEP instead the drylands program of the DA, the target fields the drylands and the actors of the drylands drama the drylands people.

In fact, ICRISAT is an active partner in the DA drylands program, which is due to start in the 3rd quarter of this year (ANN, undated, pcdspo.gov.ph). William Dar said:

We will be implementing (projects) that we have learned based on how the government of India put its money for what is important.

Since it is based in India, ICRISAT has learned much from the Government there, and India has learned much from ICRISAT, so that it has been multiplying the Adarsha watershed model in many Indian districts that have drylands.

The drylands are problematic to the farmers because there is no rain when they want it. But intelligent farmers should not be one-track minds. Yes, they should be thinking of diverse crops aside from rice. I know ICRISAT will teach Filipino farmers the cultivation of high-yielding, drought-resistant, disease-resistant varieties of chickpea, peanut, pigeon pea, and sweet sorghum anytime, if the farmers just say the word.

My mantra here is this: If you can't solve a problem, change the problem! So, there is no rain for your crop? There are many things you can do. One, change your crop! There are crops that hardly need water to grow well. Two, change your farming system! Like, you can grow rice very well with little soil water using a modified practice of System of Rice Intensification (SRI) invented by Fr Henri de Laulanie SJ in 1983 (Wikipedia). Even the growing of sugarcane, which is profligate in water, can save 50%-80% of the water if you follow the Sustainable Sugarcane Initiative of ICRISAT and the World Wide Fund (see my "Designer Crop. SSI Sugarcane & Copenhagen Calls," 02 December 2009, iCRiSAT Watch, blogspot.com).

So the DA drylands program with an initial budget of PhP 20 million is targeting 20 million farmers. The program aims to replicate the success of the Adarsha watershed in India with 500-ha village watersheds in the Philippines, which could expand to 1,000 ha, even to 2,000 ha each, according to William Dar.

That should cover some 1 million hectares of farmlands. If the average size of the watershed to be developed is 1,000 ha, that would mean the build-up of 1,000 watersheds all over the country. The goal is to grow crops in those drylands turned watersheds to help meet the food security needs of the Philippines by the year 2013.

Following the model of Adarsha, rebuilding a watershed is the people's initiative. A forest is a watershed; no, the Department of Agriculture spearheading the build-up of 1,000 Adarsha watersheds in the country is not meant to embarrass the Department of Environment and Natural Resources who has magnificently failed in the last 4 decades to rehabilitate the watersheds of the country through the paradigm of rebuilding a watershed by government initiative - but I wouldn't be surprised if it does.

Why target the drylands? Because almost 50% of the food in the Philippines comes from the drylands, according to Nicomedes Eleazar, Director of the Bureau of Agricultural Research (BAR) (James Konstantin Galvez, 28 July 2001, manilatimes.net). BAR is coordinating the DA-ICRISAT partnership program; according to Eleazar, the drylands program has 4 components: "rain-fed farming innovation; community-based watershed management and soil conservation; policy (formulation); and capacity building" (ANN, 28 July 2011, visayandailystar.com).

"Farming innovation" and "watershed management" and "soil conservation" and "policy formulation" and "capacity building" - These are the contents of the overall message to the farmers? How can the farmers support the drylands program when the scientists talk at too high a level?

To change the level of the language, I'll just say the magic word "Adarsha!" and all drylands eyes should be opened, all ears cocked.

The way I see it, the drylands people of the Philippines are supposed to learn from the drylands people of ICRISAT just one word: Adarsha. The aim is to adapt in the drylands of this country the extremely successful approach used in developing the Adarsha watershed of Kothapally in India. I have written 40 long essays about or relating to ICRISAT's Adarsha project since 2007 (you can begin with my "The Turning Point. Know that silent water runs deep," 04 October 2007, iCRiSAT Watch, blogspot.com), so I know there's much to learn.

Dar says "The 464-hectare Adarsha Watershed in Kothapally, India ... despite the abject absence of water or surface water sources like rivers, has become a successful farming village."

Note the 26-word quote: Is the Adarsha secret technical? Yes. I know it's harvesting water, especially the rains. But I also know the technical secret worked only after the social psychological secret was discovered and tapped - which one of those 26 words in the quote above do you think was that secret?

Village.

It takes a village. The original proverb that is of ancient African origin is this: "It takes a village to raise a child" (Bob, justpeace.org). It takes a village to grow a watershed. Only when you have convinced enough of the villagers, or only if enough villagers have convinced themselves, that any project can take off. "You start building a good neighborhood when you yourself decide that you will be a good neighbor." Not first with the good scientists who come knocking on your door telling you exactly what are the good things to do for your family.

It must be remembered, and remembered well, that the Adarsha watershed project of ICRISAT started from top to bottom, and it didn't work at first. The villagers were just being told what to do: construct water-harvesting structures. Nobody likes to be told. "Earlier, the approach to work in (Adarsha) had been very top-down," ICRISAT scientist Pyara Singh said, "with an emphasis on soil and water conservation and little people's participation" (quoted by Sushmita Malaviya, 2003; see my "Water lessons of Adarsha. Learning began with what scientists didn't know," iCRiSAT Watch, 02 November 2008).

It should be bottom-up. If you insist on calling it participatory, it should be that the scientists are participating as the villagers live their lives, and not the villagers participating in a scientists' project. Above all, it's about owner-ship and not stakeholder-ship. The villagers should be the owners of the development project, not just stakeholders.

You go to the village armed with the tools and techniques of rainfed farming innovation, community-based watershed management and soil conservation, policy formulation and capacity building. Who will understand you? You can lead the horse to the water, but you cannot make it drink. I think it's in the context. Those scientific tools and technologies mean nothing to the villagers; they have eyes, but you cannot make them see; they have ears, but you cannot make them listen. The trigger to look and listen will have to come from them, with just a little help from their friends - the scientists.

The Adarsha watershed has turned out to be good agricultural practice. But, learning from ICRISAT, scientists cannot simply prescribe it. The process of people participation matters, where it begins. All scientists can do at best is to inspire some neighborliness among neighbors in the village for the village to come out alive. You can't do science for development from top to bottom; it must be from bottom to top. Village development is not supply-push - it's demand-pull. It's not hard science first - it's people science first.

Another way of putting that is this: The Adarsha lesson is that it is the people who will build the watershed - after they realize that it is the people themselves who have destroyed it in the first place. Why is the Magat Dam - along with all those other dams in the Philippines - a failure when it comes to irrigation water? Because the watershed that feeds it water has been abused by the people. This is the Adarsha lesson that people have to teach themselves first before they can appreciate any attempt in their neighborhood to build-up a watershed. It is a lesson that is physical as well as psychological:

Everything depends on the villagers. Until the villagers admit their guilt, they cannot see the need to rehabilitate; until they recognize their abuse, they cannot begin to rehabilitate that which they have abused.

The Mystifying Crop Biotechnology. Understanding Media, the Extensions of Mind

2011-08-05T06:12:00.001+08:00

MANILA - If we want to make more history, we must understand media more. There are no 2 ways about it: We must study Asian media if we want Asian understanding. Who will understand science if the media don’t?

On 27 June 2011, at the Taj Krishna Hotel in Hyderabad, India, the Media Colloquium on Demystifying Crop Biotechnology: Issues and Concepts for the Asian Media was held as part of the 20th Asian Media Information and Communication Centre (AMIC) Annual Conference. So:

the F&B News reported it (fnbnews.com)
The Hindu reported it (29 June 2011, thehindu.com)
rediff business reported it (28 June 2011, rediff.com)
TheCropSite reported it (28 June 2011, thecropsite.com)
Business Standard reported it (28 June 2011, business-standard.com)
The Financial Express reported it (29 June 2011, financialexpress.com)
and many others.

Having read many of those news briefs, which were very similar and some exactly the same, it mystifies me that, despite the clear aim of the colloquium, crop biotechnology was not demystified!

I was expecting at least these 2 ways that the exchange of views will clarify crop biotechnology:
(a) translating in plain English what exactly is crop biotechnology
(b) explaining the role(s) of crop bio in modern agriculture.

The AMIC, International Crops Research Institute for the Semi-Arid Tropics (ICRISAT), Department of Biotechnology-Government of India, and the International Service for the Acquisition of Agri-Biotech Applications (ISAAA) co-sponsored the meeting. Many men, many minds. I was expecting more from the AMIC as the major sponsor of the colloquium because the focus was on media.

Emphasis on modern media. "The spread of education and general awareness on one hand and the revolutionary changes in communication and information technologies on the other hand," Indian Professor of Journalism Pradeep Mathur said in an earlier paper, "have made media the most potent means of mass education and mass mobilization in our time" (2006, satishserial.com). Frank H agrees. He says the press release has never been adequate as a medium of communication, all the more so now with modern media where information and non-information travel at the same speed as that of the electron. What remains for us experts to do is harness the power of media using the language of the masses. We are a global village, as Marshall McLuhan said; scientists and media should be able to speak the language of global man, and of local man, at the same time, at any time. Speak globally, speak locally. However, un-McLuhan-like, the message must prevail over the medium.

On its website, it is stated clearly that the AMIC is "a registered charity in Singapore with the mission of spearheading the development of media and communication expertise in Asia within the broad framework of economic, social and cultural development" (amic.org). Precisely! The media people must be taught what it is that they are supposed to be communicating before they can communicate it. If they remain mystified about crop bio, they can only communicate their confusion. How do you communicate fuzzy language?

Since India has in fact a Department of Biotechnology under the Ministry of Science and Technology (dbtindia.nic.in), I'm not surprised that the AMIC chose that country as the venue for the media colloquium. But the same basic problem remains: the lack of understanding by media of crop biotechnology. For instance, can anyone in media tell anyone else clearly right now what is meant by such terms as
biosafety
food security
self-sufficiency
bioprospecting
transgenic plant
risk assessment
genome analysis
recombinant vaccine
biodiversity conservation
environmental constraints
sustainable food production?

To the media, each of those messages is information overload! I could write a book about those.

McLuhan did say, "One of the effects of living with electric information is that we live habitually in a state of information overload. There's always more than you can cope with." Frank H says that this is where McLuhan was wrong; information overload began eons before the first crude computer was invented; it began with the first technical paper ever published, and that would be time immemorial. The technical mind has always been over-extended to the non-technical mind, so one has never understood the other. It takes two to tango.

In his Inaugural Address at the colloquium, William Dar, who is Director General of the International Crops Research Institute for the Semi-Arid Tropics (ICRISAT) said, "What we should focus on is to harness ways in which we can do a better job of using this science, a better understanding of the benefits that it brings."

Amen to that! It works both ways. That applies to both crop science and media groups. "A better understanding of the benefits" of crop bio by media should be the concern of all. With the title of his address, "Crop Biotechnology in the Fight against Poverty and Hunger," Dar made clear ICRISAT's major and continuing pro-poor policy. That gives me the idea that media need to communicate crop bio not only to the literate but more so the illiterate.

"Understanding and enhancing the role of the media in communicating biotechnology," Dar said, "is what will facilitate a flow of information between those who have the knowledge and those who require it to make informed decisions."

Right! Now then, I see that what Dar said adds 2 other dimensions necessary for successful communication of crop bio:

(a) understanding of media and their needs by scientists, and
(b) highlighting the role that media play in communicating science.

Since crop bio scientists have the jargon that is unintelligible to media, it is the singular role of the scientists to scale down their highfalutin language to that of the everyday. That is what media and crop bio both need: to understand each other when they talk to each other.

Media simply mouthing crop bio is not proper communication. Xerox copies no longer suffice. The burden of communication is on the other side; it is the scientists who must understand media if they want science to be communicated to the people. The language is the message. Those who know should know better. If the media have not learned, the scientists have not taught.

And don't forget that the media have to communicate with the poor in the language of the immanent presence of poverty and hunger. From media, communication must be inclusive of the poor.

Dar said, "Public misunderstanding about biotechnology due to lack of science-based information poses a big challenge in harnessing its full potential." Frank H says that puts a burden on the scientists, not media; we cannot communicate what we don't understand. The thing is, we in media won't admit we don't understand, so scientists must understand media so that they can be extensions of their minds.

And Dar said:

At ICRISAT, we believe that the sustained growth of agricultural biotechnology needs, among other things, science-based regulatory decisions. Since scientific advances are opening new avenues for biotechnology applications, risk assessment and biosafety research (are) essential (inputs) in our decision making process.

These are what crop bio needs: science-based regulatory decision-making, risk assessment, and biosafety research. Those indicate clearly that facts and fears about crop biotechnology are all inputs in the decision making process. The media not only have to appreciate but more so understand what those needs entail and what the facts and fears signify to the people whom they are supposed to serve. The media cannot be left clueless. The media must be taught.

And Dar also said:

We will proceed with this revolutionary science with caution, giving utmost importance to introducing biosafety measures from the initial stages of research and following precautionary (measures) during the entire product development (process).

The media should be well-informed on all that crop biotechnology entails. Scientists should not forget that science is for the people. If the challenge to media can be packaged in only 5 words, it is that they will have to discover how is it that crop biotechnology is, as ICRISAT puts it, "Science with a human face."

Communication of science is the burden of science, not media. If each of the media is clueless, to paraphrase McLuhan, then the modern medium is the modern non-message. Then no one will understand media at all!

2nd Green Revolution (5): Robert Zeigler: View of Rice Science for a Richer World

2011-07-24T07:53:00.001+08:00

MANILA - I'm looking at a bag of White Rice at home courtesy of the International Rice Research Institute (IRRI), at left, at the back. This is IRRI rice; when cooking, it smells good as it simmers. Rice comes to us free, a bag a month, 50 kilos each, an office perk for my son Paul Benjamin for being employed at IRRI. We get his bag of rice for our big family; his small family - my granddaughter Yja makes 3 - gets wife Celeste's bag of rice. They live in Los Baños; they share that bag of rice with her parents and a brother in Calamba City.

Paul is a graduate of UP Los Baños, BS Biology. I'm myself an alumnus, BSA major in Ag Education, eligible to teach in any rural high school. Like my son, who last I heard is in charge of IRRI's permanent exhibit, Rice World, who has branched into painting, I have pursued other careers: writing, editing, desktop publishing, publishing (in the American Chronicle magazine online), blogging, and authoring books. And in the Beginning, Middle and End of all those, let me not forget the learning.

I started being a regular correspondent of the American Chronicle on 11 February 2006, when I published in quick succession my first 2 essays in that magazine. Since I was one of those writers who had not been published by any newspaper or magazine in Manila, submissions rejected despite the obvious talent on display, it was a shock and a jubilation to see my byline appear rapid fire on the same day in an American publication. It was in fact an affirmation of a gift that I knew I had. From then on, I began to tell those who cared to listen that blogging is the revenge of the unpublished writer.

On 31 July 2006, I wrote the essay "Management: Relating is everything. Or, The Wizard of Rice who cultivated minds" (American Chronicle). It was about Santiago R Obien (SRO) who as a maverick manager almost singlehandedly built the Philippine Rice Research Institute (PhilRice) based in the then-sleepy Science City of Muñoz in Nueva Ecija into international renown. Now, SRO did not know I was going to write what I did. A long essay on the enviable achievement of a scientist who did not study management, and I was not commissioned or anything like that? Well, I am a non-com.

Now then, SRO learned about it and of course loved what he read and many months later, the next year, he chanced on me and asked me in Ilocano, "Isuratmo man met ni Willie Dar?" Would you like to write about William Dar? The funny thing was that, I told myself instantly, Dar is not like you. The exact words I said inside of me were: "Ket no nakapuy met ni William Dar mo, Apo." But your William Dar is not that good, Sir. A non-achiever. What I actually told SRO was this: "Yes, but I'd like to meet him personally. I don't know him. I have to interview him." I was thinking I was great when it came to interviewing people and sizing them up. But no hurry.

So one day, SRO and I visited William Dar at his home somewhere in Novaliches, Quezon City. He gave me copies of their annual reports; he had been Director General of ICRISAT for more than 7 years at that time, but I was clueless. When I browsed the publications, I was shocked. William Dar was A1! He was the exact opposite of what I thought he was. He was a natural-born leader and a high-achiever individually and institutionally considered. As the Team Captain of ICRISAT, he had built an award-winning institution; as the Director General of a research institute, he had inspired his staff from India to Africa not only to deliver the goods but in the best quality they could be made. And here was a poor boy who was pro-poor.

So I wrote my first essay on Dar and ICRISAT and published it in the American Chronicle on 24 June 2007: "The Yankee Dawdle. On Discovery Sorghum, The Great Climate Crop." The Yankee Dawdle part was about the US hesitating to acknowledge climate change and not signing the Kyoto Protocol; the Great Climate Crop was about the new sweet sorghum variety, coming from plant breeders of ICRISAT, that was drought-resistant, miserly in demanding food, prodigal in fruits and extravagant in its gifts, being all at the same time food, feed, fuel, forage and fertilizer. The Perfect Crop!

That was the start of a partnership between an institute and a journalist working thousands of kilometers away from each other. In a little while, Dar was asking me to write at least 2 essays a month to help ICRISAT accomplish its overall mission with its mandate crops - chickpea, peanut (groundnut), pearl millet, pigeon pea, sorghum - making the public aware, interested, desirous and actually propagating them. Much encouraged, from the boondocks, I went back to town, to americanchronicle.com; that's com. The essays came as fast as you can say "International Crops Research Institute for the Semi-Arid Tropics."

Then my popular science books came one after the other: December 2007, January 2009, January 2010, January 2011, all 4 being, as described by Dar in his Preface to the first book, "informative and innovative" and, as Frank H says, "always inclusive of the poor," to borrow from ICRISAT itself - so that when taken collectively becomes "Science writing with a human face."

Manager and men, through the years, ICRISAT has been learning more of how to be productive in ways of actually helping the poor to help themselves become un-poor. As I followed their progress and wrote of it, I slowly began to notice that Team ICRISAT would come up with some system, technology or concept that surprised me and my high standards of journalism. If you didn't innovate, you couldn't catch my attention, and in any case if I write about you, it will be what I'm thinking you should be thinking.

If truth be told, I didn't bite those top-heavy concepts some people were espousing in ICRISAT. So: Integrated genetic and natural resources management (IGNRM)? I ignored it. Their Impact Studies didn't have much impact on me either. The gender issue was only so much tissue. VASAT - what was that?! "Virtual Academy for the Semi-Arid Tropics." No, I wasn't excited about it. I wasn't keen on vermicomposting either. Even the recent event called "Demystifying Crop Biotechnology" was a conundrum to me. Well, nobody's perfect!

While I saw mountains of vocabulary to climb and had neither the energy nor motivation to attempt to ascend all, I was learning; I was absorbing "Science with a human face." I was immersed in the Institute's Adarsha watershed project. I was visiting the Agri-Science Park. I was tinkering with the African Market Garden. I joined the Producers Marketing Groups in Babati. I was measuring out micro-doses of chemical fertilizers with a cap of Coke in Vietnam. And today, I am pursuing the Inclusive Market-Oriented Development strategy of ICRISAT. It tires the feet and the hands, but not the heart - even if all that is poetic license. Also, I think that I am merely mirroring the zeal that emanates from Team ICRISAT.

All that is a long-winded if excited way of saying that, nearer home, the International Rice Research Institute, with Director General Robert Zeigler, should be emboldened by ICRISAT and itself join the 2nd Green Revolution. In Hyderabad on 15 June 2011, there was a global summit on it, in effect declaring war. It must be remembered that IRRI science waged with the world the 1st Green Revolution, and science succeeded but business management failed. This is the moment of redemption.

This time, both science and management are in the frontlines with the farmers and their families in the villages. Yes, to wage the next Green Revolution, we should be thinking of science plus management (see my "2nd Green Revolution (4). Dong Rasco: View of Science+ in a grain of rice and a pail of fish," 22 July 2011, iCRiSAT Watch, blogspot.com).

Now then, I would like to imagine Team IRRI thinking in terms of battles to win the war, and they are legion. To enumerate, I'm now going to summarize myself from the first essay in this series, "2nd Green Revolution (1). Frank H: A view from the outside," based on the Hyderabad Declaration, 02 July 2011, iCRiSAT Watch, blogspot.com). I'm thinking of IRRI immersed in the 2nd Green Revolution so that its applied science and slogan will no longer be simply "Rice Science for a Better World" but transformed into "Rice Science for a Richer World" in the now-poor villages. For that, the way I see it, the battles are:

(1) Food production made sustainable. Man does not live by rice alone. This calls for farming systems with crops that yield highly and at the same time resist the devastations ordinarily wrought by insect pests, diseases, and drought.

(2) Food access made sustainable. In-between harvests, farm families go hungry, the ghosts of family debts hounding them. Food distribution must be enhanced so that no farm family starves.

(3) Farming as a business made sustainable. Farmers must be taught to be businessmen and stop living on subsidy, patronage, or mendicancy.

(4) Farm families made sustainable. To augment income from farming, family members must be taught skills so they can grab opportunities for earning income on farm or off. They must be not only technically but financially supported until they are able to support themselves.

(5) Land made sustainable. Farmers must learn to cultivate the land so that it produces more, handle it so that it becomes richer, work it to replenish the organic matter taken from it, and prevent the rainwater from running away with it.

(6) Water made sustainable. Lack of water is not an excuse for inaction. There are techniques in cultivation that conserve water, such as cover cropping, trash mulching, zero or minimum tillage, and alternate furrow irrigation. (IRRI knows there is the System of Rice intensification that conserves water.)

(7) Watersheds made sustainable. It's time we all learned that the watershed is what keeps a village a village. (Ask about the Adarsha village from ICRISAT; for an idea, read my "Adarsha Alliance. William Dar as ICRISAT Manager," iCRiSAT Watch, blogspot.com.) For rice-based farms, a watershed need be only populated with multi-storey and multi-species vegetation, including legumes as soil cover, shrubs as windbreaks and trees as sources of fruits for the table or the market.

(8) Villages made sustainable. You cannot make a few families richer and at the same time allow the other families in the village to be poor or become poorer. A family doesn't live by itself alone. It takes a village to develop, or to deteriorate.

(9) Science for development made sustainable. Research for development must receive more fund support in order to thrive and be more productive. (For instance, IRRI's Golden Rice project has received financing from the Bill & Melinda Gates Foundation.)

(10) Man as a species made sustainable. Agriculture must learn to reduce its carbon footprint and not to induce climate change further. Among other practices, the judicious use of fertilizers and pesticides can bring down the level of greenhouse gas emissions to the atmosphere considerably.

Assuming all that, I rather think that IRRI needs to learn to reengineer itself. Otherwise, as the photograph above suggests - my shot is of the historic visit of GMA via helicopter in 2008 as part of the Philippine response to the rice crisis - IRRI is history. Specifically, I suggest that IRRI start with rice-based multi-cropping systems where different crops grow well along together and are soft on water and hard on pests and germs. I suggest IRRI work with the Philippine Rice Research Institute (PhilRice) to put up model farms in strategic locations throughout the islands. May I remind PhilRice: These model farms should be established not from top to bottom but from the ground up; thus was built ICRISAT’s Adarsha watershed that even the World Bank is raving about (see my "Adarsha Revisited. Impacts of CGIAR research," 20 August 2010, iCRiSAT Watch, blogspot.com). IRRI can carry out similar projects in other Asian countries.

An extra-special project that IRRI could engage in with the likes of Asia Rice Foundation is to promote the milling and munching of Brown Rice, which everybody else knows is so much healthier than White Rice. Health is wealth, but Brown Rice has been stubborn; it refuses to move fast in the store shelves. Some people will have to review their Marketing, particularly Promotion, and engage AIDA to the rescue: to increase Awareness, deepen Interest, heighten Desire, and inspire into Action. IRRI is in luck. In-house, IRRI can start by simply switching to Brown Rice the White Rice it has been distributing free to the staff. This will then slowly open the eyes of the lettered and unlettered masses to the advantages of healthy agriculture. A little paradigm shift can go a long, long way!

2nd Green Revolution (4). Dong Rasco: View of Science+ in a grain of rice and a pail of fish

2011-07-22T21:54:00.001+08:00

MANILA - From Scientist to Manager of Science. As of 04 July 2011, we have a new Executive Director of the Philippine Rice Research Institute (PhilRice) in the person of Eufemio "Dong" Rasco (Manny Galvez, 22 July 2011, philstar.com). I note Rasco has very impressive credentials as an academician: He is a magna cum laude BSA graduate of UP Los Baños, has a PhD from top-ranked Cornell University in the US, is a TOYM awardee for Agriculture, and former Director of the Institute of Plant Breeding of UP Los Baños. Before this, he was Professor at UP Mindanao, where he had designed a general education course on biotechnology, the first of its kind in the Philippines (Rizal Raoul Reyes, 12 July 2009, upmin.edu.ph). The same source states that Rasco's plant breeding efforts have been translated into commercial availability some high-performing varieties of vegetables not only in the Philippines but also in Asia.

That's Rasco working from basic science to applied science, from research to consumer goods. Not many scientists have done that. Our Filipino scientists are not usually consumer-friendly.

I know there's more of him. From my informal one-on-one interview with Rasco some 2 years ago, as a researcher, he is much like my favorite American poet Robert Frost - he loves the largely unbeaten path:

Somewhere ages and ages hence:
Two roads diverged in a wood, and I -
I took the one less travelled by,
And that has made all the difference.

At that time of my interview, he was studying the nipa palm (Nypa fruticans) that no one else seemed interested in, and among other things, wondering out loud why was it that this species thrive in both the mangrove swamp, with roots submerged 24/7 in slightly salty water on organic matter-rich peat, as well as in the lowlands, with roots submerged in almost dry soil and hardly any organic matter? If I remember right, he was also saying that his research shows that the nipa palm was as old as the dinosaurs, a survivor species. He was implying that we needed to study more the ways of this survivor palm, considering that now climate change was upon us. This was a new way of looking at Science in a palm of green.

Meanwhile, we Asians are stuck with rice; we Filipinos too are a survivor species, in no small measure because of the rice that we eat. To survive longer and better, we must change the way we look at rice. From vegetables and the nipa palm, today Rasco is into rice and, necessarily, as far as I can see, the historic challenge is for him to change the way he looks at Science in a grain of rice.

This time, the challenge is not only to make rice a survivor species but a triumphant one, and the Filipinos not only a survivor people but a rice-eating, world-class nation. The times call for Science+ - Science plus Management.

So, I propose that with PhilRice, we Filipinos join the 2nd Green Revolution. I have written a series on this; this essay is the 4th (see the one before this, "2nd Green Revolution (3). William Dar: View from Science," 09 July 2011, iCRiSAT Watch, blogspot.com).

But before we wage the 2nd Green Revolution, we must learn our lessons from the 1st Green Revolution.

Miracle Rice from the International Rice Research Institute (IRRI) based in Los Baños was what started in the Philippines and on to the rest of Asia the very 1st Green Revolution. It was wonderful while it lasted; it was the stuff that Science Legends are made of.

The 1st Green Revolution was a scientific success - unfortunately, it was a business management failure. We remembered to multiply rice but we forgot to multiply those who received the benefits from the rice bounty. This Revolution (a) cost us too much in terms of degraded resources: financial, blue water (surface and ground water), green water (rainwater stored in the soil), soil, and air, and (b) left behind the poor farmers, who went on being poor, if not poorer.

From there, 2 of the lessons PhilRice can pick up from the 1st Green Revolution are these, both from the field experiences of ICRISAT: (1) Science must go down from the top. (2) Management must be on top.

(1) Science must decrease.

"Give a man a fish, and he will have food for a day" - you know how the rest of that Chinese proverb goes. Since time immemorial, Science has assumed that all knowledge belongs to scientists and such knowledge, especially the new, must be transferred hook, line and sinker for the ignorant to learn how to fish.

ICRISAT and partners had started with some such notions with the Adarsha watershed project. I have narrated the story in my essay "Water Lessons of Adarsha. Learning began with what scientists didn't know," 02 November 2008, iCRiSAT Watch, blogspot.com). If it were a music video, the Adarsha project was on Pause as long as the scientists were insisting on soil and water conservation (Science & Technology) as the starting points. Adarsha started to Play with country music when scientists started listening to the villagers (valuing not simply people participation but villagers' initiative), and then the project went Fast Forward. That was because in the beginning, the scientists knew the real needs of the people (such as water for their crops and homes), but the people wanted to meet their felt needs first (such as food & medicine). It was as if the Adarsha villagers were saying: Your Science is good but we need Cash.

(2) Management must increase.

On top of my dedicated website, iCRiSAT Watch, I have splashed these words:

ICRISAT, a center of excellence of CGIAR.
Excellence is details below, management on top.

I rather think that PhilRice, the Science Czar of Rice in the Philippines, must now learn from ICRISAT, the Science Czar of Crops and Complementarities of the Consultative Group on International Agricultural Research (CGIAR). CGIAR is the parent group of IRRI, the Science Engine of the 1st Green Revolution, and ICRISAT, the would-be Science Engine of the 2nd Green Revolution.

Based in India and standing on top of the non-white elephant that was the 1st Green Revolution, ICRISAT has come up with a new mode of working as well as measuring the impacts of research for development (R4D) projects:

(a) Public-Private-Patron-People Partnerships - This is a radical approach to R4D that ICRISAT and partners have come up with and shown to be successful in many instances, such as the Science Park in ICRISAT's campus in Patancheru, Andhra Pradesh; the Adarsha watershed in India; and the Producers Marketing Groups (PMGs) in Africa. And such partnerships must upgrade our now-degraded resources: financial, water, soil and air.

(b) Inclusive Market-Oriented Development (IMOD) - The manna from the 1st Green Revolution did not fall as raindrops from heaven on the poor farmers of Asia, Africa and the Americas. The Middleman wiped away the sweat off the Farmer's brows and walked off with much of the values added. To counter that, the research for development effort must be managed according to IMOD. Here is the heart of IMOD: To include the poor farmers as actors - and reactors - along the whole marketing system, from the farm gate to the export market. The basic idea may be seen in the PMGs in Africa, which have enriched the villages. That is to say, where the fisherman has not caught more, the scientist has not taught more.

So, as the new head of PhilRice, Eufemio "Dong" Rasco I believe must show that he is not only an extreme academician but also an extreme manager, once more a beater of paths. At least, from the swamp to the lowland, I'm sure he is in his element.

Now then, if we do the next Green Revolution right, we fulfill our Christian duty towards the goal that the poor we shall not always have with us.

Dryland Views. Describing obstacles, deriving opportunities

2011-07-16T16:33:00.000+08:00

MANILA - A paradigm shift looks like this: From OAO to OAO. From Old As Obstacle to Old As Opportunity. And no, none is too old to make a paradigm shift!

You need Creative Thinking to look at an Obstacle, and see after that, Opportunity. It’s easy if you know the trick, if you have taught your mind to be always positive and not be negative.

Being negative is easy. Betty Friedan knows that, she who was the Creator of The Feminine Mystique, and author of the book of the same name - she dreaded to be 60. "When my friends threw a surprise party on my sixtieth birthday," she said, "I could have killed them all" (in Preface to her book, The Fountain Of Age, New York, Simon & Schuster, 1993, 671 pages):

Their toasts seemed hostile, insisting as they did that I publicly acknowledge reaching sixty, pushing me out of life, as it seemed, out of the race. Professionally, politically, personally, sexually. Distancing me from their fifty-, forty-, thirty-year-old selves. Even my own kids, though they loved me, seemed determined to be part of the torture. I was almost taunting in my response, assuring my friends that they, too, would soon be sixty if they lived that long. But I was depressed for weeks after that birthday party, felt removed from them all. I could not face being sixty.

But she was stubborn. "In the months that followed my sixtieth birthday," she said, "I grimly forced myself to study age, head on" (page 20). She began studying the problem of age, attending seminars, interviewing "men and women who had apparently transcended age to achieve the strengths that interested me." And she met women and men who told her about "surprising changes in their own lives since they turned sixty, seventy, eighty" (21). Then she began feeling "the passion of true engagement, true excitement, and adventure stirring in (her)." And then she met Mike, who was seventy, who was overweight and had had a heart attack and knew he was dying but even in the hospital was happy anyway. She told him she was looking for something she could not define (27). "It's not the fountain of youth," she said. Mike smiled and said, "The fountain of age?" It was.

It was a paradigm shift. Sometimes you need others to help you change perspectives. So, borrowing from Betty and Mike, if the drylands are promontories to climb, the intelligent thing to do is:

Do not look at the drylands as mountains of obstacles but, instead, mountains of opportunities. (And remember to not make mountains out of molehills.)

The drylands cover 6.5 million square kilometers in 55 countries in Asia, Africa, Australia and the Americas. They are technically called "semi-arid tropics" to distinguish them from the arid lands, the deserts. The lack or absence of water is the main obstacle; the supply or presence of many a package of technology that could double or triple yields in those drylands is the main opportunity, given those adverse soil, water and climatic conditions.

That is what Director General William Dar of the International Crops Research Institute for the Semi-Arid Tropics (ICRISAT) is saying in his draft paper "Dryland Agriculture in Semi-Arid Tropics: Constraints and Opportunities" to be submitted early this July to the Indian Journal of Dryland Agriculture, which is a publication of the Indian Society of Dryland Agriculture and Development.

This is a policy paper that expounds on how ICRISAT is strategizing the way it creates and conducts its programs and projects in research for development (R4D) in the drylands. Based in India, ICRISAT has been winning world-wide attention for its innovative ways of conducting successful R4D in the semi-arid tropics. (For details, you can visit their website at icrisat.org or my blog iCRiSAT Watchat blogspot.com.)

This is how Obstacles and Opportunities in the drylands can be seen in relation to ICRISAT and partners in science.

Poverty

Obstacle: "The drylands are home to the deepest pockets of poverty on earth," Dar says. There are more poor in the villages where farming is the main occupation. In 2009, there were twice as many poor in Asia than Africa, 185 million vs 95 million, but "12 out of 19 of the deepest 'poverty trap' areas in Sub-Saharan Africa were in the drylands." That's a high 63% poorest.

Opportunity:
Some 3 decades of Village-Level Studies by ICRISAT in Africa and Asia have shown that where the number of poor is declining, there you will find that the village has been connected to urban markets, and the farmers have been planting other than staple crops, not to mention finding off-farm employment. With its new Inclusive Market-Oriented Development (IMOD) strategy, ICRISAT along with its partners has a tool to make sure that science has a human face. "IMOD," Dar says, "includes a systems perspective that looks at how innovations fit together to make a functioning whole that helps the poor move steadily along a path from subsistence farming to market-oriented farming." The view must be whole, not fragmentary; then we can expert the poor to proceed from poverty to security, from security to prosperity.

Climate Change

Obstacle:
Climate change threatens poverty reduction efforts because the weather is hotter, the monsoons are shifting, and the soils are drying up even more. The poor become more vulnerable because they depend on already fragile environments for their well-being. They cannot adapt rapidly to rapid change, and their voice is not heard in climate change negotiations.

Opportunity:
there are mitigation options to minimize climate change damage, and adaptation options in agriculture such as conserving and at the same time using crop resources for food. ICRISAT already has crops adapted to high temperatures, short-duration varieties that mature before the onset of the dry season, not to mention high-yielding and disease-resistant varieties. Examples of resilient crops: Short-duration chickpea cultivars (super-early ICC 96029, extra-early ICCV 2 and early-maturing JG 11 and KAK 2) that can withstand high temperatures, pearl millet flowering at 40+°C and short-duration groundnut cultivar ICGV 91114 that escapes terminal drought.

Malnutrition

Obstacle:
Dar says, "Child malnutrition is pervasive throughout the semi-arid tropics and is a stubborn foe." What results are lower enrolments and attendances in schools, as well as higher rates of occurrences of death and disease and therefore higher health care costs. There are more malnourished children in dryland Asia than in dryland Africa.

Opportunity: "ICRISAT has made a good beginning in identifying salinity-tolerant and micronutrient dense parental lines in sorghum and pearl millet," Dar says. That is to say, they are beginning to breed varieties of sorghum and pearl millet that are packed with micronutrients good for pregnant women and children. And these varieties should be able to grow well even in saline areas.

Water Scarcity

Obstacle: There is now lack of "blue water" and "green water." Blue water is underground water; the underground supply has been depleted in many areas in the drylands. Green water is water retained by the soil after a rain; if the soil erodes, there is hardly green water left for the crops.

Opportunity:"ICRISAT believes that the alleviation of the water crisis in the semi-arid tropics can happen with the management of 'blue water' and 'green water,'" Dar says. The opportunity to overcome the obstacle is to integrate technologies that include these: crop varieties that demand less water, timely planting, efficient & optimum fertilization, effective weed control, and harvesting rainwater by developing watersheds. Community watershed projects in China and India have increased crop yields up to 4 times, incomes by 45% (China) and 77% (India). There are soils being less eroded, groundwater replenished, vegetation recovered and overall productivity increased. There are also village seed banks being set up for greater access to high-quality planting materials; income earners include poultry production, compost-making, as well as product processing.

Land Degradation

Obstacle:
This means that the site as a whole is losing its topsoil, losing fertility, and losing water. Another site may be being polluted by fertilizers and pesticides and losing its natural ability to grow crops optimally.

Opportunity:ICRISAT proposes crop and livestock integration to generate higher resource efficiency: new fruit trees, dual-purpose legumes, including poultry & small cattle. Micro-dosing is another opportunity for increasing soil fertility without increasing expenses.

Drought

Obstacle:Drought is brought about by prolonged mismanagement of the soil, drying up of sources of irrigation water, or climate change, or all of the above.

Opportunity: To adapt to climate change, "ICRISAT is harnessing biotechnology," Dar says, "to develop new varieties that are drought-tolerant." So now ICRISAT has extra-short duration (ICCV 2) and short-duration (KK 2 and JG 11) chickpea varieties, as well as a pigeon pea hybrid (ICPH 2671) that matures before the onset of the dry season. "Similarly," Dar says, "our extra short-duration pigeon pea cultivar ICPL 88039 that matures 10-12 days earlier than the local cultivar was found best suited for rotation with wheat in the Northwestern plains of India."

Plant Disease

Obstacle:Fusarium wilt is one disease that has been devastating crops in India, including banana, potato, and coffee.

Opportunity:ICRISAT has bred early-maturing varieties of desi and kabuli chickpea that resist the attack of the fusarium wilt fungus. With resistant crops, between 1973 and 2009, there has been an 11-fold increase in area, a 45-fold increase in production, and a 4-fold increase in productivity of chickpea in Andhra Pradesh.

Monoculture

Obstacle: Monoculture, the growing of a single species or a variety of a single crop over a wide expanse, is prevalent in Asia, Africa, Australia and the Americas. Because of the uniformity of the vegetation which serves as food for pests and diseases, monoculture is vulnerable to widespread infestations and infections.

Opportunity:Crop diversification is the opportunity to resolve the problems of monoculture. "The objective of diversification," Dar says, "is to encourage farmers to grow a mix of diverse crops in order to reduce various types of risks." That is to say, when you grow more kinds of crops, when one crop fails, the whole farm doesn't. Each crop is a hedge against failure. There is also the opportunity to plant high-value crops that consumers want.

Poor Nutrition

Obstacle:There is hidden malnutrition, which is the lack of certain nutrients in the diet, and visible malnutrition, which is seen as stunted growth of flesh and bones in the body.

Opportunity:"In Asia," Dar says, "ICRISAT community watersheds have introduced fruits, vegetables, herbs and medicinal plants to improve livelihoods, nutrition and health." For instance, fresh green chickpea pod has become an important source of income in Ethiopia where other vegetables are scarce. In Kenya, Tanzania, Malawi and Mozambique, ICRISAT’s early-maturing pigeon peas capture off-season high prices for green peas priced as a vegetable.

Lack of income, poor diets

Obstacle:This involves unemployed women, mostly wives, who are concerned with lack of income as well as poor diets for their families.

Opportunity:ICRISAT has set up some 2,500 African Market Gardens (AMGs) to enable commercial integration of fruits, vegetables and trees in the Sahel. An AMG is a low-pressure small-scale drip irrigation system that can be tended by a woman. AMGs have multiplied incomes more than 10-fold to US $1,500 from only 500 square meters.

Crop Residues

Obstacle:Crop refuse has not been given its due importance in the nutrition of farm animals.

Opportunity:"ICRISAT, in collaboration with ILRI animal nutritionists," Dar says, "has improved the digestibility of crop residues of mandate crops that have a significant impact on milk production, particularly in South Asia." (ILRI is the International Livestock Research Institute, based in Kenya, a sister institute of ICRISAT based in India; both are under the aegis of the Consultative Group on International Agricultural Research (CGIAR); the CGIAR is based in Washington DC and is supported by the World Bank.) Specifically, a new peanut (groundnut) variety, the ICGV 91114 introduced in the Andhra Pradesh has led to a 20% increase in the milk yield of dairy animals.

Institutions

Obstacle:There are complex development issues in agriculture and there is no single institution that can tackle them.

Opportunity:"To succeed," Dar says, "we need partnerships that address all the weak points in the system." Thus, in 2010 alone, ICRISAT was involved in 190 active partnerships and distributed its budget to partners for the conduct of R4D activities. Along with that, ICRISAT has come up with its Agribusiness and Innovation Platform (AIP) which comprises the Innovation & Partnership (IP) Program, the Agri-Business Incubator (ABI) Program, and the NutriPlus Knowledge Program. The AIP has stimulated over 100 joint ventures with agri-business entrepreneurs in India over the past five years. The IP, ABI and NutriPlus are some of the successful and innovative partnerships entered into by ICRISAT.

The overall lesson ICRISAT is trying to teach all of us in the drylands is to describe the obstacles, after which to derive the opportunities.

2nd Green Revolution (3). William Dar: View from science

2011-07-09T21:35:00.001+08:00

HYDERABAD - Science with a human face now means business. The poor farmers trained as rich-minded entrepreneurs. Rich soils, rich crops, rich fields, rich families. Then we will be witness to The Rise of The New Rich. Truly new, truly rich.

Reality check: 15 June 2011 at the Hotel Taj Deccan in Hyderabad, Andhra Pradesh, India; Director General of the International Crops Research Institute for the Semi-Arid Tropics (ICRISAT) William Dar is delivering the Theme Address for the "Global Summit on Green Revolution II: Growth Engine for Transformation."

Dar is saying the 1st Green Revolution "improved crop varieties and intensive farming techniques enhanced food grain production and helped stave off mass starvation in that era." That is to say, the 1960s saw better crops, better yields, and better food distribution. But, he says, the Revolution's "benefits were not sustained and did not fully trickle down to the small and marginal farmlands of the world." The destitute farmers remained destitute, and their poor soils remained poor. In that Green Revolution, the poor were left behind.

Not only that. Food prices have since gone up, up and away! "According to the World Bank," Dar says, "44 million people have been forced into extreme poverty by food inflation since June 2010." As per the 80-country Nomura Food Vulnerability Index, among those suffering most from costly food are 25 countries, which include India, China, Philippines, Bangladesh, Nigeria, Kenya and Vietnam." Food, food everywhere, but not enough to eat!

Overall, Dar says, yields are declining while farming costs are inclining; and food stocks are declining while food prices are inclining. Still, countries have to import food and, in 2010, the poor paid as much as 20% more than in 2009 for these imports.

After the 1st Green Revolution, "the goal for the agricultural sector is no longer simply to maximize productivity," Dar says, "but to optimize it as a business proposition." High yields are good, but what about costs? Farmers must now be taught to become entrepreneurs themselves and treat their farming as their business.

That would not be easy. The poor farmers are in the poor sites, the drylands; so, they have marginal capital, marginal soils, marginal water, and marginal yields.

And so we need the 2nd Green Revolution, and we need to wage it as a long-term investment of theory and application. Dar says, "Its long-term success will depend on a strong convergence strategy that brings together the public and private sectors and civil society through mutually beneficial partnerships." Everybody wins.

I interpret that to mean that civil government, civil business, and civil society must come together in strong convergences such that the tripartite partnerships can come up with any number of Win-Win-Win Situations. Win-Win Situations are no longer tenable.

"At ICRISAT," Dar says, "our way of contributing to the realization of the 2nd Green Revolution is our Strategic Plan to 2020." Based in India, ICRISAT carries out agriculture research-for-development, R4D, which is applied science, and no longer simply R&D, which is theoretical science. R4D in Asia and Sub-Saharan Africa, that is, in the dryland tropics where more than 644 million poorest-of-the-poor live.

For ICRISAT's 2020 plan, "We have adopted IMOD (inclusive market-oriented development) as our guiding principle," Dar says, "to empower smallholder farmers to grow their way out of poverty." The farmers must be taught to help themselves. To empower is not to give the fish, so that the farmer can have food for a day; rather, to empower is to teach how to fish, so that the farmer can have food for a lifetime.

Even so, fishing must be qualified. The fisherman must learn to not fish beyond the optimum sustainable yield (OSY). Beyond OSY is exploitation; within OSY is resilience of the system. Mother Nature must be allowed to replenish herself. You can harvest only so much fish, before the point of diminishing returns in catch as well as in cash.

Likewise with IMOD. "Through this inclusive strategy," Dar says, "we will lead smallholder farm families, particularly women and the youth, from pessimism to prosperity" (emphasis by Dar). Thus, "we are confident that IMOD as a strategy will play a vital role in the path to a 2nd Green Revolution."

Dar then challenges India to lead the poor world into the rich. "India can become the global model," Dar says, "in terms of empowering smallholder farmers to grow out of poverty and hunger in a sustainable manner." Grow but not at the expense of other people. Grow but not at the expense of the environment.

Under IMOD, the partnership is among the farmers as raisers of crops, donors as sources of inputs, science as source of technologies, and government as source of support policies. Connect the outputs along with the grower of crops to the market, and you will have a vibrant village economy.

Dar is not speaking in the abstract. I can give you 3 examples of how IMOD works in the real world, in Africa and Asia.

One is in Ethiopia. In an earlier essay ("An African Revolution. IMOD Power to the Women!" 22 September 2010, iCRiSAT Watch, blogspot.com), I said, "I think that the African version of the Green Revolution may have already started, at least about 7 years ago." Because of new, improved ICRISAT chickpea varieties, and because of direct market linkages, exports earnings zoomed from $1 million in 2004 to $26 million in 2008.

Two is in Malawi, where with its detection kit, ICRISAT helped the Mchinji Smallholder Farmers' Association in central Malawi screen out groundnuts for aflatoxin content to meet EU export requirements (May 2011, New Internationalist, cited by icrisat.org). As a result, more than 4,000 Malawi farmers are again exporting high-quality peanuts to Europe under a fair trade agreement.

Three is in Adarsha in the village of Kothapally in the district of Ranga Reddy in the state of Andhra Pradesh, India. Adarsha is a watershed that was not so until the villagers convinced themselves that the watershed project of ICRISAT and partners was for their own good and all it needed was their initiative. Today, as the partners have helped the Adarshans help themselves, in that village in that once dry watershed, there are lower costs and higher returns:

There are more children going to school.
There are more women contributing to income.
There are more households earning more.
There are more water for farms and homes.

ICRISAT and partners started the Adarsha watershed project in 1999; where poverty reigned before, today the villagers have thriving self-help jobs that earn them welcome income. In Adarsha, they practice multiple cropping; they grow rice, cotton, maize with pigeon pea, and high-value crops such as carrot, cabbage, tomato, chili, sorghum, chickpea, and flowers. They produce milk from crossbreeds at 200-900 liters a day. They have micro-credit arrangements and some women have put up grocery, tailoring and embroidery shops.

Adarsha has been such a success story that several TV stations - regional, national and international - have featured it (icrisat.org). The concept has been emulated in Thailand, Vietnam and the Philippines.

Now then, the 2nd Green Revolution starts in the villages, with the poor. The success story of Adarsha shows that the new science for development dictates that the poor farmers must conserve the village resources. The success stories of Ethiopia and Malawi show that the poor farmers must be rewarded by being connected to the market themselves. With the 2nd Green Revolution then, the poor farmers can truly be richly rewarded, and the rest of us in society truly enriched by its multiplier effects.

2nd Green Revolution (2). Dilip Modi: View from the business side

2011-07-05T08:15:00.001+08:00

HYDERABAD - 10 by 10 by 2020 is a summary of the 2nd Green Revolution that India wants to wage - looking at it from the perspective of the bottom line. It's about time!

In his speech at the Green Revolution II Summit in Hyderabad on 15 June 2011, the Indian Associated Chambers of Commerce & Industry (Assocham) President Dilip Modi began with these words:

"Agriculture not only gives riches to a nation, but the only riches she can call her own" - how true these eternal words of famous writer Samuel Johnson.

We believe in these words and Assocham has taken this humble initiative to work on the roadmap … for the state of Karnataka and across the country. I am confident that today’s meet on ‘Green Revolution II’ will launch a new momentum to drive the economic, social and environmental aspirations of the agriculture sector.

Under Modi's leadership, Assocham has drawn the roadmap for 10% growth increase in agriculture generated via a 10-point Action Plan up to 2020. The Plan is as follows (Modi's words in italics):

1. Create an Integrated Soil-Crop-Climate-Market Plan on a national basis with a formal consultative mechanism between the Centre, state governments and farmers.

By "Centre" the speaker must mean the International Crops Research Institute for the Semi-Arid Tropics (ICRISAT), one of the international agricultural centers under the aegis of the Consultative Group on International Agricultural Research (CGIAR) based in Washington DC. The CGIAR is supported by the World Bank. ICRISAT and Assocham are the two giant bodies that conducted a joint study on how to launch the Green Revolution II in India contained in the report "Second Green Revolution: Growth Engine for Transformation" (pdf, 80 pages). The verdict? Green Revolution II is different - and doable.

2. Present a separate Agricultural budget for this critical sector to help generate the ecosystem to foster sustainable and profitable agriculture.

A separate fund specifically for Green Revolution II is to be raised as it is necessary to spend for initiatives to induce and insure an overall agriculture program that is both profitable and sustainable, not one or the other.

3. Recognize and encourage the role of the private sector in agricultural development. Today, the private sector is exploring opportunities to participate in several areas including irrigation, power infrastructure, hybrid seed development and contract farming and Assocham will be happy to catalyze these partnerships.

Agriculture must be treated as a business proposition by everyone, including the poor farmers. The business sector can contribute business partnerships in many areas such as listed above.

4. Adopt and implement the “One Nation, One Market” concept, and remove all road blocks in agricultural marketing.

Modi does not explain what the concept of "One Nation, One Market" calls for in terms of the Revolution; the Internet is eerily silent on it, so I cannot elaborate. I am however aware that partner ICRISAT will insist on inclusive market-oriented development (IMOD). IMOD is democratic.

5. Integrate agriculture education with application-based R&D to enhance productivity. This is feasible through strong public-private partnership.

Frank H understands that to mean that education should now be leading more students towards learning to be producers and entrepreneurs rather than job seekers. This will need new private investments and new government policies in support.

6. Move from consumption subsidies to capital subsidies to generate long term growth.

There will be less subsidies for food and more subsidies for capital investments from the private sector. We must stop giving fish to the poor so that he has food for a day and teach him how to fish so that he will have food for a lifetime.

7. Create incentives for irrigation and infrastructure investment for optimum productivity.

This calls for government to encourage business to invest in irrigation and other infrastructure with new incentives for such private initiatives.

8. Ensure financial inclusion, through adequate and timely finance at low rates of interest as well as insurance to cover unknowns.

I take that to mean that the poor farmers are to be assisted in financing their small farm businesses with affordable loans as well as insurance against calamities natural and unnatural.

9. Promote sustainable agriculture such that technology adoption is in harmony with optimum utilization of soil and water resources.

Any old techniques applied, or new or improved technologies adopted must now result in the wise use of soil and water. That is to say, soil should be conserved, not eroded; water should be retained by soils rich in organic matter, not wasted by runoff.

10. Develop alternate farming methods like Organic Farming. Assocham will be happy to work with your government and farmers to develop a master plan for contract organic farming that increases revenue per hectare. We are also keen to tap the processing opportunity and help farmers explore global markets for their produce.

These would be welcome news from such endeavors. I'm imagining such products as Certified Organic Chickpea, Certified Organic Peanut, Certified Organic Pigeon Pea, Certified Organic Pearl Millet, and Certified Organic Sweet Sorghum.

"As Assocham," Modi said, "we would dedicate our resources to enable knowledge transfer and competency building of our farmers through linkages with corporations and research institutes." Technology transfers will be encouraged, but with the caveat that the farmers become competent in applying them through the support of both business and science.

"Andhra Pradesh is already showing the way with effective public- private partnership models," Modi said. "I am delighted to inform you that through Anil Jain irrigation’s innovative drip irrigation, yield per hectare in rice has increased substantially from 3.1 tons/hectare to 9.38 tons/ha." That is an increase in yield by 300% with the programmed use of water. While water is efficiently used, yield is effectively increased. "Such innovations," Modi said, "are the key to solving the issue of food security in the country."

Indeed, Modi said, "Time has come to treat farmers as entrepreneurs." (Frank H: And for farmers to behave as such.) "Agriculture has to be remunerative to those engaged in it." (Including the poor farmers.) Modi suggested that agrarian reforms include technology adoption in both production and processing. (Frank H: Not to forget marketing. Agriculture must now include the poor farmers as actors not only in production and processing but more so in marketing, for them to truly and fairly enjoy the fruits of their labors. It's about time!)

2nd Green Revolution (1). Frank H: A view from the outside

2011-07-02T11:35:00.006+08:00

MANILA - Do you want to be part of a Revolution with warriors from another country and 14 of them each marching with an 80-page blueprint in their hands and talking to each other in technical Jargon?

Two weeks too late the hero. They already did it on 15 June in India. Reminds me of the gamble-gambol of Senator Antonio Trillanes & Brigadier General Danilo Lim in 2007 at the plush Peninsula Manila; at the elegant Taj Deccan Hotel in the City of Hyderabad in the State of Andhra Pradesh, they also meant business, serious business. The difference? One was Rebellion, the other Revolution. Those Hyderabad 14 holding the blueprint had helped shape the radical roadmap, all of them coming from the revolutionary camp called ICRISAT headed by its unconventional Captain, William Dar.

In Manila, they were calling for A Rebellion Against the President. In Hyderabad, they were calling for A Revolution for the Poor. It's a matter of priorities.

A Rebellion is always forgettable. So, mind the Revolution, not the Jargon. Where in Manila Trillanes failed to rally the other camp, there in Hyderabad the other camp was in full force and applauding as it joined the march, prepared for the battles ahead. The other camp was Assocham, led by its progressive President, Dilip Modi.

Assocham with ICRISAT. This is Science and Commerce in the business of Revolution. We have the International Crops Research Institute for the Semi-Arid Tropics (ICRISAT) providing the Technology, and the Associated Chambers of Commerce & Industry (Assocham) of India providing the rest of the Time, Talent & Treasure. They have suited themselves to a T. Talk of The Perfect Revolution!

The next Green Revolution is unlike the first in that it is Business and Science leading, and it is A Revolution for the Poor. Since when? Since June 2011.

They did it during the "Global Summit on Green Revolution II" in Hyderabad featuring national and international speakers from government, industry, academia, multi-lateral agencies, embassies, and attended by exporters, industry representatives, government officials and international experts. This must be the first serious Revolution in the world to have:

(1) published to the world and yet been ignored by major papers in Africa, Asia (except India and the Philippines), and the Americas (except by American Chronicle)
(2) included the poor farmers as revolutionaries
(3) forged a partnership of public, private and patrons if not philanthropists to engage in the Revolution.

They don't make Revolutions like they used to anymore!

On one hand, a Revolution is always scary. You're scared of the sacrifice it will exact from you; you're scared that it will fail. Truth to tell, into the 80-page Blueprint for Revolution entitled "Second Green Revolution: Growth Engine for Transformation," the rebel planners put in all-too-many sets of data and all-too-serious statistical computations I was surprised they didn't frighten themselves to analysis paralysis. The explanation? A Revolution must be SMART: Specific, Measurable, Achievable, Realistic, Time-Bound. And: A Revolution must transcend rules, borders, limits.

On the other hand, did The Silent Majority of Journalists think the leaders of Assocham and ICRISAT were engaged in hyperbole like journalists are wont to do? Then they were wrong. This is the next Green Revolution and it's unlike what they've ever heard or seen. Green Revolution II is creative, social - GR2 is genius.

If you don't have any idea, I forgive you. Now then, I can summarize GR2's ultimate call in five words: Sustainability, inclusive of the poor. The battles for GR2 are for:

(1) Food production, sustainable.

This calls for crops that yield highly and at the same time resist the devastations ordinarily wrought by insect pests and diseases. This also calls for drought-resistant crops and livestock where water has recently become scarce.

(2) Food access, sustainable.

The poor need to eat also, and regularly. In the villages, there occurs The Farmer's Irony: While his crop grows healthy, the farmer grows hungry. The ghosts of family debts hound the household. Now then, after food production, food distribution must be enhanced so that no farm family need go starve.

(3) Farming as a business, sustainable.

It is time that farmers learn to be businessmen and know how to manage risk, earn profit and mitigate loss. They can't live forever on subsidy, or patronage, or mendicancy.

(4) Farm families, sustainable.

To augment income from farming, family members must be taught to grab opportunities for earning income on farm or off. They must be supported until they are able to support themselves.

(5) Land, sustainable.

Not only the best but suitable practices must be the norm when it comes to the employment of the soil for production. We must handle the same land so that it produces more; we must use it so that it becomes richer, cultivating it so that we replenish the organic matter that we take from it, and prevent the water from running away with it.

(6) Water, sustainable.

Lack of water in agriculture is not a reason for failure - it is a reason for action. There are techniques in cultivation that conserve water, and we must use them: cover cropping, trash mulching, zero or minimum tillage, alternate furrow irrigation etc.

(7) Watersheds, sustainable.

It's time we all learned that that the watershed is what keeps a village a village. (Ask about the Adarsha village from ICRISAT; for an idea, read my "Adarsha Alliance. William Dar as ICRISAT Manager," iCRiSAT Watch, blogspot.com.) This truth is evident where the water for crops and livestock now comes from underground and no longer from the forested mountain upstream because, as the dying river indicates, the forest is going, going, gone. You cannot separate the Forest from the Farm.

(8) Villages, sustainable.

It is no longer acceptable that the village rich get richer while the village poor get poorer. A family doesn't live by itself alone. It takes a village to develop, or to deteriorate.

(9) Science for development, sustainable.

Meanwhile, further research for development must receive not only more fond support but more fund support in order to thrive and be more productive. If it were soil, it must be enriched so that the crop can grow fruitful and multiply the harvest.

(10) Man as a species, sustainable.

No, you cannot separate the Fate of Man from the Fate of the Earth. Agriculture must learn to reduce its carbon footprint and not to induce climate change further. Among other practices, the judicious use of fertilizers and pesticides can bring down the level of greenhouse gas emissions to the atmosphere considerably. We owe it to the rest of us.

Now then, I envy those who made the Hyderabad Declaration of Revolution. Now they are rebels with a cause. In fact, they have millions of causes - the poor people in the villages of Asia, Africa and the Americas. It's about Time - and Technology, and Talent, and Treasure. It's about US.

2nd Green Revolution (0). From Pessimism to Possibility to Prosperity!

2011-06-30T14:34:00.006+08:00

HYDERABAD - 40 years ago, the Green Revolution led by Norman Borlaug was a smash success in doubling yields, trebling incomes, and quadrupling hopes - but not in helping the poor farmers rise from poverty. It was not in the design.

11 years ago, KP Prabhakaran Nair wrote in the 05 May 2000 issue of Business Line (online) that it was "Time for Green Revolution II," calling for higher-yielding crop varieties coming from India for India (hindu.com). He wanted higher yields, but only from crop varieties coming from India, not abroad. That would be tantamount merely to localizing Green Revolution I, not transforming it enough to merit a new name, Green Revolution II. It was not in the design either.

16 months ago, on 8-9 February 2010, the Ministry of Agriculture of the Government of India and the Associated Chambers of Commerce and Industry of India (ASSOCHAM) sponsored the "Global Meet on Revolution II" in New Delhi. The emphasis was partnering with the private sector for higher productivity (assocham.org). Like Nair's proposal, this was merely extending the life of Green Revolution I. Longevity was in the design, not transformation.

15 days ago, on 15 June 2011, I am happy to report that Assocham itself sponsored the "Global Summit on Green Revolution II - Growth Engine for Transformation" (assocham.org) and, yes, this is indeed revolutionary, world-shattering. It called for transforming India as a model for the whole world.

On that occasion, Dilip Modi, president of Assocham, said the Indian chambers should emphasize "Soil-to-crop-to-market," with emphasis on alternative farming practices and sustainable agriculture. And not to forget the village poor. Such as in Andhra Pradesh, Modi said, "The State must promote small-scale, tiny, artisan units to reduce poverty and unemployment through low-capital investment." Small is beautiful.

On the same occasion, Assocham and the International Crops Research Institute for the Semi-Arid Tropics (ICRISAT) released the results of a joint study, "Second Green Revolution: Role in Transforming Indian Agriculture" (ANN, fnbnews.com). Based on the study, Modi said Green Revolution II will "focus on holistic development of the agriculture sector (as it) is imperative to support small, marginal farmers in sustaining their livelihood." These are the farmers in the lands that time forgot.

Holistic, inclusive. The Assocham-ICRISAT joint study recommended "end-to-end services." I understand that to mean from the farm to the market up to the consumer, and not simply up to the farm-to-market road.

"An inclusive market-oriented approach can revolutionize India's agricultural sector," Secretary General of Assocham DS Rawat said, "lure youngsters to take it as a business venture and shun conventional career options and come up with better agricultural practices to improve productivity and quality."

That is right down ICRISAT's alley. In his Theme Address entitled "From Pessimism to Possibility: Ushering in a Second Green Revolution" for the conference held at the Hotel Taj Deccan, Director General William Dar of ICRISAT said the benefits of the next Green Revolution should be "sustained (and) fully trickle down to the small and marginal farmlands of the world." The small have been easily overlooked.

It is not a simple proposition, Dar said:

The goal for the agricultural sector is no longer simply to maximize productivity but to optimize it as a business proposition across a far more complex landscape of production, rural development, environmental, social justice and food consumption outcomes.

Dar was saying the next Green Revolution must be beyond higher yields. For the farmers, it must now become a business, considering costs and returns not only to the farming family but also to other families in the village and beyond, the returns not only food and monetary but also environmental and social. Farming cannot be sustainable if the poor farmers remain poor, if the soil is abused, if the environment is degraded, if farmers don't get the benefits that they deserve because the market system denies them.

The challenge for the next Green Revolution (or the Evergreen Revolution as MS Swaminathan calls it) is the drylands, Dar said. (Swaminathan was Director General of the International Rice Research Institute, IRRI 1982-1988; the IRRI rice-based Green Revolution in Asia happened before him.) Already they are fragile environments, soils and all; yet, we need them to produce more food. Now then, this calls for "a strong convergence strategy that brings together the public and private sectors and civil society through mutually beneficial partnerships."

More to the point, Dar said:

At ICRISAT, our way of contributing to the realization of the second Green Revolution is our Strategic Plan to 2020. We developed this plan to give us direction to achieve six institutional outcomes – food sufficiency, crop intensification, crop diversification, system resilience, nutrition and health, and women empowerment.

ICRISAT has adopted inclusive market-oriented development (IMOD) as its "guiding principle to empower smallholder farmers to grow their way out of poverty." IMOD is "inclusive" and "market-oriented" because it includes the poor farmers as beneficiaries of values added to their produce along the local and international market systems; it is "development" because there is a multiplier effect in the village. Public-private partners are there to provide support as appropriate, but the farmers must group themselves to empower themselves. They can learn from, for instance, the Tanzanian women farmers assisted by ICRISAT and of whom I wrote about almost 1 year ago (see my "ICRISAT strat. Drylands & the economics of the little," 28 September 2010, iCRiSAT Watch, blogspot.com).

Through the strategy that includes, Dar said, we will lead the poor farm families in the villages from here to there to thereafter, from pessimism to possibility to prosperity.

Since India is the first country receptive of IMOD as a strategy, "India can become the global model," Dar said, "in terms of empowering smallholder farmers to grow out of poverty and hunger in a sustainable manner." And since the local government has been lending good support to the idea, "the Andhra Pradesh government can show the way forward."

Green Revolution II, or the Evergreen Revolution, calls for not simply addition but transformation for it to happen and grow. Can we? We can make the next Green Revolution happen, Dar said, together with governments, civil society, the private sector, and partners like Assocham. "We owe it to the smallholder farmers and the poor people in the developing world!"

We still need more investments, more technologies and more partners from government and the private sector. But the next Green Revolution should not be only for more food but for more values added to more people as the farm produce goes from the farm to the table. Business for everyone, inclusive of the poor farmers. Quantity with Quality, and some eQuality: How about that, World?

Adarsha in my mind. Language on my lips

2011-06-28T17:40:00.001+08:00

MANILA - In science, knowledge is not the problem; the language is. Marshall McLuhan says, "The medium is the message," Mark Twain says, "Clothes make the man," and Frank H says, "Man makes language the message" or "The language is the message." The problem with scientists is that they're always talking to their peers - even when they're talking to us journalists!

I don't blame the scientists. As an educator, here's my challenge to the universities in Asia, Africa, Australia, the Americas: Teach scientists a language other than their own. It's not too late: Get them to attend Continuing Education. Or get them collaborators who are popularizers. Or get them mentors online.

Meanwhile, for the edification of those institutions of higher learning, I'm thinking of Adarsha. The first time I met her was in late September or early October 2007 when I came across the paper written by TK Sreedevi, B Shiferaw & SP Wani and published in 2004 in the SAT eJournal of the International Crops Research Institute for the Semi-Arid Tropics (ICRISAT) based in India and headed by Director General William Dar. The title of the paper was "Adarsha Watershed in Kothapally: Understanding the Drivers of Higher Impact" (icrisat.org). The document was in pdf. Technical. A piece of writing as dry as the semi-arid tropics. Typical.

I'm not unfamiliar with watersheds. From 1975, I worked for 5.5 years as Chief Information Officer of the Forest Research Institute (FORI) based in Los Baños, so I should know about watersheds. But, I'm sad to say, there was no understanding the drivers of higher impact. What drivers were they talking about? What higher impact?

So, since the scientists could not educate me on the matter, I decided to educate myself.

Actually, I'm not new at this. Since I began working for FORI, I had always been fascinated with watersheds, and this time the Adarsha watershed sounded like a romantic story that I would be very glad to be the first to tell that story. But, like a woman, I had to understand her first.

You know very well it's not easy. Well, I have always been self-taught: writing, editing, desktop publishing, blogging, book writing, promotional campaigns. So, the first thing I did was keep my mouth shut and my eyes open - and went ahead and read.

Downloading the document and using Adobe Reader to read the pdf now, I scroll down to page 1, after the title; I'm at the Background; I stop at the first four sentences:

Water, the very basis of life and the single most important feature of our planet, is the most threatened resource today. In rainfed areas, watershed management is the approach used for conservation of water and other natural resources as well as for sustainable management of natural resources. A watershed is a hydrologically defined area that is drained by a network of streams, which meet together in such a way that the water leaves through a common point. A watershed is made up of soil, vegetation and water along with the people and animals who are the integral part of the system.

A watershed is very complicated, such as it is! If you read something like that, what do you do? I can't give up now. I have to try to understand.

1st sentence: Water as the very basis of life, I understand perfectly. Water, the single most important feature of our planet; I ask myself: Not Man? Water, the most threatened resource today; I ask myself: Not oil? I'm learning, I'm learning.

2nd sentence: Too complicated to consider right now. In any case, from the 1st sentence, I get the idea that the story of the Adarsha watershed is all about, or above all, water. Pass.

3rd sentence: This is actually a technical definition of a watershed. Let me consider the parts. Hydrologically defined area - bounded by water, from hydro, water. Drained by a network of streams - if you have ever been to a forest, that's what you see, streams and falls near you, or around you. Which meet together in such a way that the water leaves through a common point - like a river. Now you know that rivers always come from watersheds somewhere. Application of that piece of knowledge: If the river has dried up, the watershed has dried up earlier. If the Angat Dam water level has gone down, Metro Manila gets less water because the watershed that feeds the dam has been degraded by loggers big and small, and firewood & charcoal gatherers.

4th sentence: This is actually a realistic definition of a watershed: the inter-actions of the soil + plants + animals + people. Now we're getting somewhere. Application: A forest is a watershed. If you rebuild a degraded area into a forest but only plant trees, that's only tree planting. You have to envision restoring the richness of the watershed (forest) soil, envision reestablishing the diversity of vegetation (flora) and the welter of wildlife (fauna), and envision people living off the watershed. No wonder, 50 years of reforestation efforts in the Philippines have utterly failed: Utter lack of vision.

Pages 2 to12 I'd rather skip, too technical for me. I jump to page 13 - I will just note that I skipped 7 tables of numbers and 10 figures. Scientists love tables and figures lying around. Tables are dry data; figures are dry drawings. I'd rather ogle at photographs because they show virtual reality.

I search (press Ctrl+F) for the word "drivers" and the cursor jumps to the section Identifying Drivers of Higher Impact. Finally! Reading now, I understand that "drivers of higher impact" means "the factors that contributed to the transformation of people's lives in (the) Adarsha watershed."

That means: (a) in Adarsha, there have been desirable changes in people's lives, and (b) we know the reasons or causes of such desirable changes.

Now then, does this technical paper provide us the specifics of the transformation? Sad to say that, up to the final word of the final page (19), I can't find a list pertaining to or describing that social transformation.

Instead, the paper lists 10 drivers of higher impact, now you know what I mean. But since I'm more interested in the transformation than the causes of such transformation, I won't discuss those. I will now search for other documents pertaining to Adarsha. What is the World Wide Web for if not surfing; what is the Internet for if not searching?

I google for "Adarsha watershed" (double quotes included) and I get 4,260 results; I google for Adarsha watershed (no quotes), I get 57,000 results. I decide to check out the results for "Adarsha watershed" first because that search is more specific.

So, I check out the results, one by one. A great many webpages later, all technical, I come to the article "Saving Asia's delicate watersheds" written by Junelyn S de la Rosa (July 2004, bar.gov.ph). Finally, I get a list of the good things that have happened in Adarsha (my own listing):

(1) richer soils
(2) more vegetation
(3) common grazing lands rehabilitated
(4) doubling of income from cereal crops
(5) increased groundwater level, about 3 meters
(6) more food throughout the year, including fruits
(7) new sources of income off-farm: poultry, animal feeds, composts.

More webpages later, I find this Adarsha farmer speaking very nicely about Adarsha (4 May 2004, Narasimha Reddy as quoted by Lalitha Sridhar, groups.yahoo.com):

We started in 1999. Now we have watershed committees and a sense of better control over our lives. In the four-year period since 1999, all watershed management activities have been incorporated. Check-dams and other techniques helped us increase the water in our wells. ICRISAT helped us in other ways too. Many of us were growing cotton, which is labor-intensive and pays poorly - more expense and less profit. Now we grow maize and pigeon pea. These have improved yields and made farming easier. Earlier it was poor income and sometimes loss. Most people migrated. But now we are able to stay because it is worthwhile to remain in the village.

"But now we are able to stay because it is worthwhile to remain in the village." After all is said and done, if the scientists can't speak the language, let the farmers speak for themselves!

ICRISAT Talk? IGNRM, IWM, IMOD. I'll simplify & say, "Adarsha!"

2011-06-23T19:33:00.001+08:00

MANILA - Distance lends enchantment to the view. I'm glad I'm more than 4,000 km from Andhra Pradesh in India, not by any stretch of the imagination near the campus of the International Crops Research Institute for the Semi-Arid Tropics (ICRISAT) in Patancheru. I imagine the talk on campus every day is about integrated genetic & natural resources management (IGNRM), integrated watershed management (IWM), and inclusive market-oriented development (IMOD), not to mention food sufficiency, intensification, diversification, resilience, health & nutrition, women empowerment, farmer-participation, and the consortium approach. Science is not journalist-friendly, is it?

What I have just enumerated is all theory. But you can be sure, with ICRISAT, applied science is knowledge user-friendly. I mean, the villagers have benefitted from ICRISAT tremendously.

I received email about the news item authored by SP Wani, "Integrated Watershed Development For Sustainable Development Of Rainfed Areas" (February 2011, ICID News, icid.org), so I'm glad to write about one of my favorite ICRISAT subjects: Adarsha. Did you know that in the last 77 months, I have mentioned it in 35 long essays in the American Chronicle (also published in my dedicated blog, iCRiSAT Watch, blogspot.com)? Because Adarsha is a romantic story, and I am a romantic at heart.

As a teacher, I note that in the success story of the Adarsha watershed, the scientists went in there to teach the villagers and came out learners themselves. The villagers themselves taught the scientists, indirectly of course, the language of demand (by would-be buyers of technology) vs the language of supply (by would-be sellers) when it came to assistance in the name of development.

Adarsha is in fact a new community watershed at the Kothapally village in the Ranga Reddy District of Andhra Pradesh in India. It is about 40 km south of the ICRISAT campus in Patancheru; it spreads over 465 ha. It wasn't there before or, rather, it was wasteland before science visited the place and insight chanced upon the villagers.

To me, Adarsha is the village that a watershed built. I do not separate the watershed from the villagers who live, love and move in it, more than 1,500 of them. It was in fact the villagers who gave the watershed the name Adarsha, meaning ideal (trueknowledge.com), "an ultimate goal" (Frank H), "a goal example worthy to be followed" (unccd.int). There was virtually no village to speak of before the Adarsha Project; the villagers did not see how they could work together for their common good.

Before 1999, water was the common bad. Water wells dried up and the water table went down. The rains were not enough to grow the crops well. When the rains did come, the soil was sure to go with the outflow. When the crops did grow, they yielded little. The villagers depended solely on their farming, which could not be depended upon most of the time. As the soils dried up, so the villagers' hopes.

Starting in 1999, in that dryland, Adarsha became Actors and Advocates working together for a common goal: restoring a community watershed. The villagers acted in their behalf and ICRISAT & its Partners (Public, Private, Patrons) acted in their support: MV Foundation (MVF), Central Research Institute for Dryland Agriculture (CRIDA), National Remote Sensing Agency (NRSA), District Water Management Agency (DWMA), and the Ranga Reddy District Government (RRDG) of Andhra Pradesh. The project obtained financial support from the Asian Development Bank (ADB).

From 1999 onwards, slowly but surely Adarsha was transformed from a wasteland to a vibrant village.

From the reports of SP Wani (as cited), SP Wani, TK Sreedevi, HP Singh, P Pathak & TJ Rego ("A Success Story!" ag.udel.edu), and TK Sreedevi, B Shiferaw & SP Wani, "Adarsha Watershed In Kothapally" (icrisat.org), I gather that Adarsha as a package of knowledge and folk wisdom has:

(1) increased crop yields 2-4 times
(2) multiplied family incomes 2 times
(3) reduced water runoff more than 50%
(4) decreased soil erosion 14%
(5) replenished water below-ground
(6) restored plant and animal life above-ground
(7) rebuilt family & village lives.

Adarsha is a grand lesson for all reforestation and afforestation projects in my beloved Philippines.

I did say folk wisdom. This was largely forgotten at the start of the project. At the beginning, ICRISAT Soil Scientist Pyara Singh said, the approach had been "very top-down, with an emphasis on soil and water conservation and little people's participation" (quoted by Sushmita Malaviya, 2003, tribuneindia.com). Improved cultivars, moisture conservation, water harvesting, afforestation, contour bunding, check dams, percolation tanks, gabion structures, and gully plugs - at first, they were just so much science to the villagers; they had little to do with those.

The way I see it, the modern phenomenon called Adarsha all began when people’s participation was transformed from individual employment to people's initiative. That is to say, from being merely contracted to construct water harvesting structures, the people finally saw that the project was for their own good and began to volunteer what little they had in terms of time, ideas, materials and efforts. At last, the people appreciated that they were helping themselves, and at the same time the partners finally appreciated that they were helping the people help themselves.

Technically, Adarsha can be seen as ICRISAT's "New Model of Integrated Watershed Development," and that it has these 8 "important components" (TK Sreedevi et al, as cited); my summary:

1. Collective action and farmer participation from beginning
2. Consortium of institutions for backstopping
3. Principle of “users pay” - no free rides in the program
4. Demand-driven approach - no supply-driven technologies
5. Integrated resource management
6. Low-cost soil and water conservation measures
7. Knowledge-based entry point to build rapport with community
8. Tangible economic benefits through on-farm interventions.

As a matter of fact, the experts can list more of the important components of Adarsha as a new model for community development if they wish. This is what I wish to say about the list:

The people must be allowed to exercise their right in taking part in the decision process, not simply being told what to do.

The farmers must learn to demand of themselves self-sufficiency, not simply demand favors from society.

To the scientists, the first time, the villagers can bluntly state it this way: "Your technology is good, but we need cash." That is, if they are articulate. Chances are, they're not.

Nonetheless, first, they need food, and they cannot eat consortium for breakfast. Next, they need to understand, and they cannot sleep trying to digest integrated genetics & natural resource management at night. Then they need to secure their future a little bit, and they cannot appreciate inclusive market-oriented development until it all turns liquid in their own hands!

Unlike the biblical manna, science is not a product but a process, and for the people to profit from it, The AIDA Doctrine should operate here. The people should be made Aware of it, then gain Interest in it, then Desire it for themselves, and eventually Act to fulfill that desire.

In other words, the success of Adarsha can be seen this way:

When the villagers saw that Adarsha was their project, that they owned it, the wasteland turned from poor to rich.

Now then, how can the success of Adarsha be duplicated in other parts of India and in many countries in Asia and Africa? I leave the technical components to the experts. I want to concentrate on the people components. To answer that question, I the journalist and student of science am interested in the process and would like to further ask these questions:

How did the people take the project at first?
What happened during the first several months?
When did the project stop being simply top-down?
What were the turning points along the way to growth?
Whose paradigm shift(s) made the difference?

Armed with answers to those questions, we can all fully learn from Adarsha, a watershed in the history of social transformation among the poor in the drylands of Asia and Africa.

Green Water? Blue Water, Time For Creative Capitalism, People!

2011-05-25T18:53:00.001+08:00

MANILA - "You found a solution in the Green Revolution," Johan Rockstrom, Executive Director of the Stockholm Resilience Centre of the Stockholm Environment Institute, tells Neha Poonia (01 November 2009, punemirror.in). Rockstrom is implying that the Green Revolution was good while it lasted. "This (new) situation demands another revolution, a Green Water Revolution." He is implying that the Green Revolution was actually a Blue Water Revolution - irrigation was the key - and we cannot rely on that now. We have to adapt to Climate Change.

Almost suddenly, water is the crux of the matter in agriculture. Green Water has become a powerful idea for exploring what can be done especially in the drylands to make them more resilient, as in, more productive at much less cost, starting of course with much less water. To me, the Green Revolution was actually a Seed-Based Revolution; it stands to reason that now Rockstrom is advocating a Water-Based Revolution. Interestingly, in the first, there was no lack of good seeds; ironically, in the second, there is lack of good water.

Is it really water? Bancy M Mati & Nuhu H Hatibu say, "Failure to 'manage' water has been identified as the major problem associated with poor agricultural productivity in Eastern and Southern Africa (ESA) Region" (2006, iwmi.org). ESA is not alone. David Zaks & Chad Monfreda say, “Rainfed agriculture is at the mercy of two things: rain and the capacity of the soil to capture and store that rain” (“Green Water and Sustainable Agriculture,” 26 May 2006, worldchanging.com).

How good is water? Sturle Hauge Simonsen says, "Better 'Green Water use' can reduce future food crisis" (February 2009, albaeco.se). In fact, Simonsen quotes experts of the Stockholm Resilience Centre of the Stockholm Environment Institute and the Potsdam Institute for Climate Impact Research (Rockstrom & Company) as saying, "This opens a new area of investments for climate adaptation and a window to achieve a much needed New Green Revolution in poor countries in the world." (bold supplied). Are the advocates of Creative Capitalism listening?

No, the Blue Water / Green Water paradigm is not new; it is actually 16 years old, having been proposed by Malin Falkenmark for an FAO conference on water and agriculture in 1995 (Simonsen, as cited). Blue Water is that which you find in rivers and lakes, including groundwater. Green Water is that which is caught and held by the soil and vegetation after the rain falls. We do have a choice: Green or Blue?

Current agriculture is focused on Blue Water - it is being tapped for irrigation. But where it is available, it is expensive; where it is not available, the only choice is Green Water - if it's available.

Now then, how do you produce Green Water for your crops in the drylands when there is no rain? You can't. But you can catch the rain when it falls where it falls. It's called rain harvesting or water harvesting.

And that is one of the great lessons out of the success of the Adarsha Watershed in Kothapally in India that was developed by the villagers in a collaborative project by the Government of Andhra Pradesh with the International Crops Research Institute for the Semi-Arid Tropics (ICRISAT) headed by Director General William Dar and participated in by public-private partners based in that country. The collaborators included the M Venkatarangiaya Foundation (an NGO), Central Research Institute for Dryland Agriculture, National Remote Sensing Agency, and the District Water Management Agency.

Adarsha is located some 40 km from the ICRISAT campus in Patancheru. With undulating topography, the watershed is all of 465 ha, 430 ha of which are farmed, the rest uncultivated.

The population is about 1,500 belonging to some 270 farming and 4 non-farming families. All 270 farmers are members of the watershed association, which is registered under the Registration of Societies Act. They have a Watershed Committee, the executive body. Self-help groups handle specific watershed management activities. User groups operate and maintain water-harvesting structures. Women self-help groups undertake village-level enterprises, such as vermicomposting and planting high-value vegetables, for income. With all those activities, no wonder this village is alive.

On 18 April 2010, a World Bank team visited Adarsha, and the members were amazed (ANN, 23 April 2010, ICRISAT Happenings 1411):

The transformation is visible. The World Bank team members, after alighting from their vehicles, said, "This is a very prosperous village. Are we sure that we are in Kothapally? This village stands out from our normal imagination of a village in Asia or Africa."

Believe it, ladies & gentlemen. I haven't seen it myself, but blessed are those that have not seen and yet have believed!

The Adarsha Watershed Committee was the one that identified potential sites for working-in the rain harvesting structures. Eventually built were 14 check dams (13 masonry and 1 earthen) with a capacity ranging from 300 to 2,000 cubic meters, 97 gully plugs, and 60 mini-percolation pits, 1 gabion, including a half-kilometer long diversion bund to avoid damage to croplands. 38 ha were identified for field bunds. Some 50,000 saplings of the legume Gliricidia were planted as live fence for the bunds as well as to supply loppings that when applied on the soil make nitrogen-rich organic matter.

Thousands of fruit trees and teak plants were planted along the roads, field bunds and small streams, including a custard apple plantation, so that the wasteland became like half-forest, half-farm (see image). The Adarsha Watershed is once again a living watershed, which I think is what every farm should be part of.

As a result, open wells near small streams were recharged where before they were already dry. Soil erosion was reduced, and so was runoff of water after the rain.

Runoff is the rainwater that the soil doesn't catch and hold; the soil catches much of that water if the soil is rich in organic matter, which the Adarsha soil now has plenty of.

Interestingly, the latest study, published online just this month, 15 May 2011 by wileyonlinelibrary.com, and authored by Kaushal K Garg, Louise Karlberg, Jennie Barron, Suhas P Wani and Johan Rockstrom, shows that all the Adarsha interventions have been good. Garg and Wani are with the Resilient DryLand Systems of ICRISAT while the other authors are with the Stockholm Resilience Centre of the Stockholm Environment Institute in Sweden; their Adarsha study is a computer-based 30-year simulation using the modeling software ARCSWAT 2005 (Version 2.1.4a).

The study indicates, among other things, that Adarsha runoff is decreased by more than 50%, which means the soil withholds more than 50% more of the rainwater than before. There is more Green Water. Adarsha groundwater recharge is increased by more than 200%. There is more Blue Water. Soil erosion is lower, and the yields of crops are higher. Adarsha pays more.

With funding by the Asian Development Bank, the Adarsha watershed management approach has been introduced in Thailand and Vietnam by ICRISAT, with good results, according to P Pathan, SP Wani, Piara Singh, R Sudi & Srinivasa Rao (2002, icrisat.org). Adarsha works better.

In fact, Johan Rockstrom advocates a watershed approach to upgrade rainfed agriculture (ist.psu.edu). Actually, we need more than that; we need a model for a total watershed management approach not only to upgrade farming but along with that upgrade the way of life of the farming families of the watershed village. It takes a village. And we have that model now: the holistic Adarsha Watershed as inspired and initiated by ICRISAT and partners.

You see, Adarsha is not simply the generation of Green Water; it is also the generation of Blue Water. More than those, the Adarsha success is explained by the development of an entire watershed where it had mostly disappeared - and most of all, the growth of the Adarsha village people in a dryland community.

We have data from an Adarsha report by SP Wani, HP Singh, TK Sreedevi, P Pathak, TJ Rego, B Shiferaw & SR Iyer, downloadable as pdf (2003, icrisat.org). For cereals (sorghum), the net income (land and labor considered) is 45% higher with irrigation, more than 100% higher without irrigation. For pulse crops (chickpea and pigeonpea), the net returns is more than double with irrigation, almost double without irrigation.

Irrigation with Blue Water plus no irrigation with Green Water - with the Adarsha approach, your entire village is a winner rain or shine.

Now then, the grand Adarsha lesson is that what we need for the drylands of Asia and Africa is neither a Green Water Revolution, which is good, nor a Green Water-Blue Water Revolution, which is better, but no less a Watershed Revolution as our new, inclusive, wide public-private investment area, which is best.

And Team Captain of ICRISAT William Dar is the one whom we want to ask first!

ELISA at ICRISAT. Meet "Economics with a human face"

2011-05-11T15:22:00.001+08:00

PATANCHERU - Ever alert for the application of "Science with a human face" - the very idea which it so happens this photo beautifully shows - from India, the International Crops Research Institute for the Semi-Arid Tropics (ICRISAT) noted that on 4-6 May 2011 was going to be held the World Economic Forum on Africa 2011 with the theme, "From Vision to Action, Africa's Next Chapter" (weforum.org). Then in the same online advanced story, ICRISAT made a fundamental observation (ANN, author not named, icrisat.org):

The rich and powerful gather in South Africa this month to consider ways to "craft innovative partnerships between business and civil society." Yet there is little mention of agriculture on their agenda, despite over 60 percent of Africans working in the farming sector.

We are talking of delegates from many countries attending the World Economic Forum in Cape Town, South Africa; in those early days of this month, they came, they said, they concurred. No, there was no mention of agriculture, not even in the Home page of their website (weforum.org). While the economists were of one mind concerning innovative partnerships, they were not of one mind concerning innovative partnerships with farmers.

Where's the New Economics there? I'm a teacher by profession, a writer by confession. But Economics is not really a foreign language to me, for at least 4 reasons. One, English is not really a foreign language to me - in the Philippines, English was the medium of instruction when I was in Grade School (mid-1940s), high school (1950s) and college (1960s). Two, I graduated in 1965 from the University of the Philippines Los Baños at the time when you had to pass Economics 1 and 2 if you wanted to pass your course, any course. Three, I'm an eclectic, voracious reader; I read even the fish wrapper from the market. Four, in the early 1960s, I read and reread, avidly, the textbook at that time, American economist Paul Samuelson's new, improved Introduction to Economics, because it was immensely readable; it was, if I may say so, Economics at your fingertips.

Becoming immensely popular all over the world, with his books Paul Samuelson became the "Father of Modern Economics" (independent.co.uk); he won the Nobel Prize for Economics in 1970. He died 13 December 2009 at 94, but the ghost of Samuelson haunts world economics to this date. His popular economics was Keynesian, that is to say, all business and government; agriculture is there, somewhere, but you'll have to look hard for it - good luck!

So, if I know the economists, except the geniuses, their heads are above the clouds, and can see neither the forest nor the trees, much less the rice and corn fields at their feet. So, I'm not surprised that those who discussed the economics of development of South Africa ignored the grammar of agriculture - which means they couldn't construct a good sentence using the word development.

The economic thinkers of the WEF forgot the farmers and farm workers in their deliberations. The WEF's own website states (weforum.org):

The World Economic Forum is an independent international organization committed to improving the state of the world by engaging business, political, academic and other leaders of society to shape global, regional and industry agendas.

Can't find agriculture there. As it looks, the WEF is out there to improve the state of the world using the old-fashioned paradigm of Leaders know best, especially the articulate ones. Now then, either these business, political, academic and other leaders of society don't understand agriculture, or they relegate it to a minor role in development, or ignore it altogether, so it's no wonder you can't find agriculture in their agenda.

Another way of looking at it is this: Economics is the Policy of Scarcity, while Agriculture is the Policy of Abundance. Two people are talking. Economist: "We have scarce resources." Agriculturist: "Go and multiply!" Then they go their separate ways.

Borrowing from ICRISAT, what we are looking for is "Economics with a human face."

If we have problems of development today, it is not that the developed countries have too much technology and the developing countries too little - that can be taken care of by technology transfer. But the problem is that we have too many economists and too few agriculturists. Another way of putting that is this: The economists have too much leadership and the agriculturists have too much followership. This is economics leading the charge and agriculture paying the price.

Today as well as yesterday, we have 2 problems with agriculture, and they both involve economics actually:

One, the problem with agriculture is economics:
What the farmer produces, the middleman takes away.

The farmer grows the crop and harvests the grains. The middleman moves in via the farm gate, buys the grains at a price that he dictates, and moves out, profits at his fingertips.

Now then, in the case of chickpea grown by eastern African farmers, what ICRISAT has done is ally with an array of national partners and farmer organizations using a market-driven strategy (Annual Report 2004: Sowing the Seeds of Success, page 18). The partners sow the 1st-generation seeds (F1). The next-generation (F2) seeds are handed over to farmer organizations called Producer Marketing Groups (PMGs). Each PMG selects farmers who multiply them and sell the 3rd-generation (F3) seeds to the PMG. The PMG then sells the F3 seeds to traders in regional and international markets. The PMG is a system of commercialization by farmers of their own produce. Traditionally, it is the middleman who knocks at the farm gate; today, the middleman is the farmer himself; that is, the produce waits for no middleman but goes straight to the market, through the PMG.

That is to say: Farmers produce. Farmers handle. Farmers market. The PMG is non-racial, non-denominational, non-geographical: African or Asian, believer or heretic, farmers benefit in each link of the market chain. The PMG is the way to go today; this is the Real Farm-To-Market Road; it's more than physical, it's more than economics in theory - it's economics in practice. It's economics for everyone, including those who can't define economics to save their lives.

Again, borrowing from ICRISAT, the PMG is "Economics with a human face."

Out of Africa, out of the PMG experience, among other things, ICRISAT has come up with a strategy that it calls the IMOD: Inclusive, Market-Oriented Development. (See my series of IMOD essays beginning with "An African Revolution. IMOD Power to the Women!" 22 September 2010, iCRiSAT Watch, blogspot.com). The IMOD is the Big Picture; it is "Development with a human face."

Two, the problem with agriculture is government:
What the farmer produces, the government takes away.

Since governments have imposed increasingly strict food safety standards without considering costs of crop production, small farmers have been thrown out of the marketplace simply because quality testing is out of their reach, if you will pardon the mixed metaphor. Where government has ignored this problem of small farmers, it is government ignoring economics ignoring agriculture.

Now then, in the case of farmers in India, what ICRISAT has done is conduct research on how to control the aflatoxin content of peanut and other crops, including ginger, black pepper, turmeric and coriander (ICRISAT Annual Report 2002: Research for Impact, pages 7-8). The word aflatoxin is derived from the first letters of the common mold called botanically Aspergillus flavus (afla) that produces the poison (toxin). Long-term intake of low levels of aflatoxins results in aflatoxicosis, which has been reported from Taiwan, Uganda, India (ansci.cornell.edu). People don't want poison in their food. To detect aflatoxins in farm products before distribution and prevent consumer dis-ease as well as expensive recalls, collaborative R&D work by ICRISAT and the Scottish Crop Research Institute has generated a tool kit called the ELISA, the name describing the process in technical terms: enzyme-linked immunosorbent assay (August 2009, SASA, icrisat.org). Never mind the jargon; the photo above shows that the ELISA kit enables a technician to simply screen for the toxin in a peanut cake bought from a local farmer. Where aflatoxin analysis used to cost $3 via thin layer chromatography (TLC), with ELISA it now costs only $1. TLC is not only more expensive; it is also more time-consuming. And yes, the mountain doesn't have to go to Mohammed anymore - the ELISA technician can always visit any mountain-high pile of farm produce. With ELISA, smaller is more beautiful.

Because it is much simpler, ELISA is "Science with a human face." Also,
because it is much cheaper, ELISA is "Economics with a human face."

Thinking out all of the above, it occurs to me that I can translate "With a human face" into a modern, popular catchword of computer nerds: "User-friendly." African and Asian farmers are users of science and appliers of economics, so these must be friendly to them. I can see that ELISA is hardware and software with a human face (check out photo again). Having said that, I notice that, inadvertently, ICRISAT has shown the way the Information Highway should travel:

"Software with a human face."
"Hardware with a human face."

And the economists of this world? They should learn from ICRISAT and come up with their own models of "Economics with a human face." Easily comprehensible, Paul Samuelson's Nobel-Prize Economics was reader-friendly; Modern Global Economics must be shown to be user-friendly.

Power to the Poor, People! CIAT, ICRISAT, IFAD, MMSU, Vietnam

2011-04-30T09:44:00.001+08:00

HO CHI MINH CITY - The costs of fossil fuels rise for city travelers even as the biofuel crops grow for country toilers; the oil prices shoot up fast while the fuel crops raise their stalks slowly. It is not yet a win-win situation. The race still belongs to the swift and the strong. Black oil is beautiful to them, not us.

I see that the growing of biofuels is the growing of our Green Hope for Mother Earth. I also see that while biofuels are in fact a little strange even to the poor farmers who grow them, IFAD and ICRISAT are no strangers to each other. The International Fund for Agricultural Development (IFAD) is one of the agencies of the UN, while the International Crops Research Institute for the Semi-Arid Tropics (ICRISAT) based in India is 1 of 15 international research centers under the aegis of the Consultative Group on International Agricultural Research (CGIAR) based in the US, as is the International Rice Research Institute (IRRI) based in the Philippines. IFAD and ICRISAT (along with other CGIAR centers like IRRI) are both into the development of agriculture, especially involving the poor farmers and their families.

"Power to the Poor!" might as well have shouted William Dar, Director General of ICRISAT in his welcome remarks titled "Biofuels: Power to the Poor" at the Expert Consultation on Biofuels held at the IRRI campus in Los Baños, Laguna, the Philippines on 27 August 2007. Today, Thursday, 28 April 2011, in Ho Chi Minh City and elsewhere, what Dar said almost 4 years ago is truer: "We're all shocked at how gasoline is emptying our pockets of cash these days." Including those of us who have no cars. We all have to pay the high price of neglecting the principle of sustainability since May 1876 when Nicolaus Otto invented "the first practical 4-stroke internal combustion engine" powered by gasoline (ANN, inventors.about.com). For almost 100 years after Otto, we never thought of squandering gasoline, this non-renewable energy resource, until the 1973 oil crisis. Gasoline was Power to the Rich! And all the more so now.

Biofuels are Power to the Poor, People!

The sweet sorghum story continues. After the 27 August 2007 biofuel consultations in the Philippines, IFAD, the Food and Agriculture Organization (FAO), and ICRISAT conducted on 8-9 November 2007 a "Global consultation on pro-poor sweet sorghum development for biofuel production and introduction to tropical sugar beet" (ANN, ifad.org). Since I've been enamored with sweet sorghum as a hardy, multi-purpose crop excellent for poor farmers in the drylands of Asia and Africa since I first met this crop in February 2007 (see my “The Yankee Dawdle. On Discovery Sorghum, The Great Climate Crop,” 04 February 2007, American Chronicle), I will focus here on this "pro-poor energy crop" as it was referred to in the summary report of the global discussion.

Somebody forgot to state the venue for the 2-day global consultation, an important piece of information, but I forgive those who prepared and those who approved the electronic report, in pdf format, because it contains a good summary of the advantages of sorghum over sugarcane as a biofuel crop. And these are:

(1) "Sweet sorghum is an efficient converter of solar energy, as it requires low inputs and yet, is a high carbohydrate producer." That means if you grow this crop, in general, you get more for less. If you are the landlord, you get more bang for your buck. If you are the farmer, less pain, more gain.

(2) "As a drought-tolerant crop with multiple uses, it is particularly important for farmers in fragile agro-economic conditions." That is an extremely loaded statement, but I like it. That means:

(a) Sweet sorghum grows well even on moisture-challenged soils. And there are plenty of those in the drylands of Asia and Africa.

(b) Sweet sorghum has a great many uses: food, feed, fodder, fertilizer (mulch or compost), fuel (bagasse), and fuel (ethanol), in which case, I am inspired to call sweet sorghum an F6 crop (unlike sugarcane) - it has more uses; even as sweet sorghum is a C4 crop (like sugarcane) - a good converter of sunlight into stored energy in the form of carbohydrates.

(c) Sweet sorghum is crucial to farmers who are marginalized (poor people) and who reside in marginal sites (poor soils). With sweet sorghum, a little water goes a long, long way.

(3) The sugar content of sweet sorghum ranges from 12 to 21%; like sugarcane, the syrup can be converted directly to ethanol, no translation necessary.

(4) Sweet sorghum is a multi-location crop; it grows well under greatly diverse climates, from temperate to subtropical to tropical. You can't say that of sugarcane.

(5) Sweet sorghum is a double fuel crop - the stalk as well the grains can be used as sources of bioethanol. Unlike sugarcane.

(6) The sweet sorghum bagasse has a higher nutritional value than sugarcane when fed to livestock.

(7) You can grow 2-3 crops of sweet sorghum (3-5 months) per year, but only 1 crop of sugarcane (10-12 months).

(8) Sorghum demands two-thirds less water to grow than sugarcane.

If Secretary of Agriculture Proceso Alcala is listening, I say it's time we paid two-thirds less attention to sugarcane and three-thirds more attention to sweet sorghum!

I want to add there that I know if you ratoon sweet sorghum, the yield is even more than the main crop! And the 2nd and 3rd ratoons will give you even more! (info sheet on sweet sorghum, bar.gov.ph). Also, the info sheet says the sugar content of sweet sorghum is 15-23%; since the report is based on plantings in the Philippines, this means that Philippine soils are richer and give more sugar for your sorghum than anywhere else.

In Ho Chi Minh City on 14 April 2011, they held the third and final annual review of the IFAD-ICRISAT project conducted for 3 biofuel crops: sweet sorghum (in India, the Philippines, China and Mali), cassava (Vietnam and Colombia), and Jatropha (India and Mali). The crops had been bred, designed or selected to produce bioethanol (sweet sorghum and cassava) and biodiesel (Jatropha) enough to sustain not only the distillers but also the farmers - and the supply of biofuels.

Ho Chi Minh City continued what IFAD and ICRISAT had begun in their ongoing relationship. In the biofuel R&D review in this city, Dar congratulated the R&D teams of CIAT (another CGIAR center), ICRISAT, MMSU (a state university of agriculture in Northern Philippines where the drylands are), Nong Lam University (Vietnam), and NGOs "for meeting all the deliverables of the project" - producing the seeds, generating the production techniques, and transferring the knowledge to the private sector where possible. Producing knowledge, generating hope, and transferring both to those who need them most. This is the slow lane, slow but safe.

In the fast lane, "peak oil" was reached in 2005, according to Scientific American (as cited by Teodoro C Mendoza, December 2007, Impact Magazine, scribd.com), while biofuels have hardly taken off the ground.

Peak oil, all the more we need bio oil, which knows no peak. And while the burning of oil continues to contribute to the carbon dioxide depot in the sky, the growing of biofuel crops continues to gobble carbon dioxide from the atmosphere. Maximum oil, maximum pollution of the air. Max bio oil, max depollution of the air. The planting of a biofuel crop is a clean air act.

So I appreciate sweet sorghum like ICRISAT appreciates the support of IFAD in terms of funding for biofuel projects. In fact, it can be said that the relationship between IFAD and ICRISAT goes a long, long way back.

Kanayo Nwanze was appointed IFAD President on 18 February 2009 at the UN Headquarters in Rome, after which Dar said of him:

We have one leader in IFAD who understands the importance of developing and supporting agriculture to help the poor. His solid science and research background augurs well for the CGIAR as well.

It happens that Nwanze was a Principal Scientist (Entomology) at ICRISAT from August 1979 to November 1996. So this is another science manager who happens to understand the need for crucial R&D in agriculture. (That, the science fund managers in the Philippines don't understand, except those of PCARRD and BAR.)

The IFAD-ICRISAT partnership was already seen as very fruitful as early as 2 years ago. The joint statement "IFAD and ICRISAT" officially issued on May 2009 said (icrisat.org):

IFAD assistance has made a marked difference in the war ICRISAT wages against hunger and poverty. Thousands of SAT farmers have learnt to practice safer, more efficient agriculture, thus making their struggle against erratic nature easier. This partnership has given them new hope and an unshakeable belief in a better future. The faith of these millions of poor in the semi-arid tropics needs to be sustained, in order to fulfill the promise of Science with a Human Face.

I know "Science with a Human Face" is a mantra of ICRISAT since 10 years ago. When Director General of ICRISAT & science manager William Dar looks into the mirror, he sees a very poor boy of Santa Maria, Ilocos Sur in Northern Philippines who was born in 1953. He understands what it is to be destitute.

PAC in Magalang. "Education with a human face" - William Dar

2011-04-21T21:16:00.001+08:00

MAGALANG, PAMPANGA - She is in my memory forever. The first time I visited the town of Magalang was more or less 50 years ago when I was a student teacher from the University of the Philippines' College of Agriculture (UPCA). I have fond - and not-so-fond - memories of my stay there, as I fell in love with a sweet, innocent girl next door, literally - and at the same time I fell flat on my face as a student teacher, almost literally - I failed and had to repeat my student teaching subject. I had a taste of teacher education with a human face.

Pampanga Agricultural College (PAC) was then the Pampanga National Agricultural School (PNAS); I was enamored with teaching, with the place too; unfortunately, I wasn't enamored with my teacher adviser, and he gave me a failing grade. It was a he. What happened? Let me put it this way: He wanted the two of us to be more than friends, and I didn't relish the idea. Teacher-to-teacher education, and I was unwilling to learn, so I failed to make his grade. I have forgiven him since then. Goodbye to all that!

At PAC in Magalang, was I a good student teacher in the first place? I know I was. I knew what I was doing; I studied my subject matter, like learning how to tie the different rope knots myself before teaching the boys and girls the square knot, hangman's knot, grandfather's knot whatever. Before my assignment to PNAS, I practice-taught at Rural High School, which was under UPCA and right on campus in Los Baños (UPCA became UP Los Baños only about 10 years later, in 1972). If you don't know high school students, they try to bug their teachers, especially practice teachers. Quite a few times, the boys in my class would answer my academic questions with something entirely off the mark, even stupid, but I never flinched, I never got angry. Don't get mad, get even! When I heard something crazy, I always said, "Correct!" even if I knew it wasn't. When the boys first heard that, they were shocked. Then they smiled. After a pause that refreshed, I followed my correct/incorrect remark with this: "But ..." and whatever I said after "But," the boys always smiled. Nobody was embarrassed, and they appreciated that. They couldn't embarrass me, and I didn't embarrass them. To this day, those boys greet me "Sir." You can't forget either the bad boys or the good boys. I prefer the good. (I must add here, lest my story be misunderstood, that I did pass my practice teaching - at the Quezon National Agricultural School in Pagbilao.)

Half a century ago, when I was there, was PNAS already a good school? I wasn't interested, or competent in judging the curricular offerings of the school, but PNAS must have been above average because UPCA, a proud school of the proud University of the Philippines System, was willing to send her students to learn teaching there.

How about PNAS reincarnated as PAC now? The last time I visited Magalang and wrote about Pampanga Agricultural College was 3 years ago to the date, 18 April 2008 ("The Osims Years. A campus grows in Magalang, Pampanga," The Frankenstein Mindster, blogspot.com). (It should have been Ozims.) And yes, PAC at that time already had outgrown its PNAS adolescence and grown up and now exuded her own charms as to be noticed. The College's vision was "An improved quality of higher education in particular, and quality of life in general." During the Ozims Years, when Zosimo "Ozims" Battad was President, from 1999 to 2007, the College became one of the leading institutions of learning in agriculture and allied sciences in Central Luzon. No mean feat, that.

I wrote at that time: "I have just described a College that deserves to become a University." Well that might be more so now. That day of May 2008 when I visited the PAC website at pac.edu.ph, it was very slow; today, 19 April 2011, it is very fast. PAC is learning about good, better, best in what it does. To me, a computer nerd, how the institution treats and uses the Internet as a knowledge management tool is a very good measure of how good the management of that institution is, or continues to be.

As I write these lines on 19 April 2011 at 2035 hours, I can also see that the PAC website's banner photo story is: "Dr Dar receives the Doctor of Humanities honorary degree from PAC President Dr Honorio Soriano" on 12 April 2011.

The man from ICRISAT in India pays tribute to the people at PAC in the Philippines during the College's graduation ceremonies, saying:

We in ICRISAT define our core value as "Science with a human face," indicating our commitment to put people's welfare first when setting our priorities.

So it is not a coincidence that William Dar is given an honorary degree of Doctor of Humanities!

I believe that PAC is treading the same path, of harnessing "Education with a human face," incorporating socio-economic dimensions in the academe particularly to contribute in shaping a sustainable and inclusive Philippine agriculture, and in fighting poverty and food insecurity in the country.

That phrase "sustainable and inclusive" in fact appears in the very title of Dar's acceptance speech at the 30th Commencement Exercises of PAC: "Leading the Path to Sustainable and Inclusive Agricultural Growth." Not surprisingly, ICRISAT has come up with an institutional strategy for the next 10 years at least, that which it calls "Inclusive Market-Oriented Development" (IMOD). For sure, it was Team ICRISAT who generated IMOD, but it was Team Captain William Dar who was the brain power behind the notion.

Dar says, "Our strategy focuses on helping the farming poor harness markets to increase their food supplies and incomes." The aim is for farmers or their allies to connect to the market superhighway directly and enjoy the benefits of the long ride from farm gate to consumer door. Dar is implying that IMOD should now become part of the educational offerings of PAC.

"Inclusive" means you must include the poor as actors in development, the poor no longer simply as reactors, no longer you the benefactors encouraging the poor in cultivating themselves as beneficiaries, that is to say, mendicants. The experts' top-down approach to development in fact is the one that fertilizes the soil of mendicancy of the poor.

To the PAC graduates, Dar says, "We in ICRISAT define our core value as 'Science with a human face.'" Frank H will now gladly revise that to say, "Science with a (poor) human face," with the parentheses putting emphasis on the poor. Dar's concern for the poor is deep-felt - he comes from a poor family. The poor you must always have with you - in your heart.

"I believe," Dar says, referring to the Pampanga Agricultural College itself, "that PAC is treading the same path, of harnessing 'Education with a human face.' Frank H understands that to mean that PAC includes enough science in economics and sociology in the courses it offers to students so that they may appreciate how they can contribute in reducing poverty in the Philippines.

Following Dar's thinking, I believe, Frank H says, that the Philippines must practice "Government with a human face" so that it will learn that it needs to give priority to agriculture, to boost research and development for the poor farmers to produce more food for others and earn more income for themselves.

To the Pampanga Agricultural College, Dar says, "I commend PAC not only for its high standard of education but also for leading the youth of this region to embrace the mission of shaping the future of our agriculture."

To the graduating class of PAC, Dar says, "As you face a new and different world that brings both great promise and great peril, you won't find the answers from your professors anymore." That is what education is all about, isn't it: learning to ask the questions and then go and find the answers by yourself. Dar answers his own unasked question as he says:

You'll find them by joining the ranks of dedicated professionals who will serve your poor people and help turn the Philippines around. You'll find them by contemplating on the future of your country and countrymen, by striving to be pioneers and treading the unbeaten path rather than taking the trodden easy and quicker path.

You must be active agents of change, Dar is telling the PAC graduates. You must be pioneers; you must be risk-takers of change. You must not only make a difference - you must make a big difference:

As scholars and professionals, you need to be a part of that change to make a big difference, working with the government, with the private sector, and with the civil society to contribute to the attainment of a sustainable and resilient agricultural growth.

Dar is telling the graduates to work with partnerships in mind, just like ICRISAT has been patently showing the world the kind of partnership that works, and excellently so: science (for innovations), government (for policy support), business (for entrepreneurship), philanthropy (for more funds), non-government organizations (for advocacy), and the people themselves (for themselves).

That is to say, to borrow from the great American President Abraham Lincoln, in working for the greatest good for the greatest number, as Democracy is, so Development must be: of the people, for the people, by the people. Development with a human face.

Science of the Inarticulate. IMOD as ICRISAT's new drylands strategy

2011-04-09T11:43:00.001+08:00

MANILA - I'm Maet Tasirci, the son of a dryland farmer of Asia; in fact, my mother is Asian and my father is African. Through my friend the journalist, I just heard that the International Crops Research Institute for the Semi-Arid Tropics, ICRISAT, which is based in India, has just come out with a brochure on the Institute's new strategy they call Inclusive Market-Oriented Development, IMOD, especially dedicated to poor farmers in both Asia and Africa. I have learned that IMOD is a product of consultations across Team ICRISAT's 3 regions: Asia, West & Central Africa, and Eastern & Southern Africa. ICRISAT and partners had wanted to discard the Silver Bullet approach to destroying the Vampire of Poverty. It wasn't working. The specter was still stalking the regions.

ICRISAT Team Captain William Dar says:

We needed to understand better how development actually happens in the drylands. How can it be triggered? How can it be sustained, so that these regions need not always depend on emergency relief aid? How can the poorest be involved? And given the diversity of dryland settings, how can diverse solutions be scaled up for wide impact?

And so ICRISAT began to learn from the poor farmers, the literate learning from the illiterate the art & science of the inarticulate, as exemplified in the Adarsha success story of ICRISAT. William Dar says, "We realized that the poorest farmers are really stuck in a poverty trap." Without money, they cannot buy farm inputs; without added inputs, their farms produce less; without surplus, they have nothing to sell - and nothing to buy inputs the next year. "So the poverty cycle just repeats itself," Dar says. "This engine is not gaining traction. It is just spinning its wheels."

Beyond the abstruse language of the IMOD brochure that is beyond the fingertips of Frank Hilario and Bill Gates, and from what I know of ICRISAT, I'm trying to understand it from the point of view of a scholar from the countryside, thinking of a farmer who has a family to nourish and wife to support him as much as she can. You see, family is paramount to me.

The poor farmer's dream is of course for his family first to rise from poverty and eventually to prosper from the fruits of their own labors. But in Asia and Africa, can the families ever? The common view of experts is that the poor families of the poor lands in these poor regions will always remain unresourceful and unproductive failures. That's because they don't know what's good for them.

Differently, led by William Dar, ICRISAT experts, along with public and private partners, came in to Asia and Africa, and learned even as they brought in new advocacy with innovation, The New AI (my coinage) - modern understanding of farmers, modern seeds, modernized policies, modernized investments, modernized marketing and other support services. And they found that with The New AI, poor farmers can communicate with scientists on their own terms, grow a watershed where none grew before, grow more with less, connect more to the market and earn more - including earn back their dignity as people.

In practical terms, The New AI translates into new added income. It calls for a farming family to produce its own food surplus: one part to serve as buffer in times of scarcity, enjoying value reserved; the other part to connect to markets, enjoying values added as the farm produce transforms along and traverses the marketing highway. With its new added income, a farm family can buy as necessary more food, and as needed more inputs such as seeds, fertilizer, labor, tools, livestock, insurance, and even formal education. It’s a win-win situation.

Multiply a successful single farm family into a village, and you will see, William Dar says, "these will further raise farm productivity, triggering a series of investments leading to economic growth." It takes a family to rise from poverty; it takes a village to rise to prosperity.

The cycle of prosperity goes on to take a country. It takes a country to become, for instance, once again a major exporter to the world. With ICRISAT and partners collaborating with the National Small Farmers' Association of Malawi, that country has returned to being a well-accepted source of peanut (groundnut) for the European Union market. ICRISAT's small contributions have grown big: peanut varieties that are both higher-yielding and disease-resistant, and an inexpensive system for detecting and controlling aflatoxin.

With things like that, Dar says, ICRISAT and partners can "help the world to reduce poverty, hunger, malnutrition and environmental degradation in the dryland tropics." At the very least, the drylands will become less poor, less hungry, less malnourished, and less ravaged.

We are talking here, Dar says, of 300 million people in the dryland tropics living on less than 1 dollar a day, officially referred to as the level of "absolute poverty." Not only that; another group, 700 million live on less than 2 dollars a day. "People who are this poor," Dar says, "live in a constant state of hunger and insecurity. They spend their days working hard in the fields, but get little for it because their lands are depleted and drought-prone." Without The New AI, the poor farmers in Asia and Africa work with old seeds, tired soils, and parched fields. Without The New AI, the poor farmers cannot respond intelligently to climate change and other environmental stresses.

William Dar says:

(The tropical drylands) are facing a convergence of pressures that we call "a perfect storm." The poor are the most vulnerable to the storm; they have the least resources to cushion these shocks. If the poor are to survive the perfect storm, it won't be through piecemeal, Band-Aid type approaches. We need a long-term, holistic strategy for reducing their vulnerability.

Dar says the perfect storm is a swirling chaos of climate change, land degradation, loss of biodiversity, food crisis, energy crisis, and population explosion. To help dissipate the perfect storm, to support what I call The New AI, ICRISAT's new and improved strategy includes acquiring new investments in research on one hand and investments in development on the other. Dar says all that calls for building the capacities of crops, the capabilities of soils, as well as the competencies of the poor farmers, including women and youth, in the villages. For instance, for the landless and women at the Adarsha and other watersheds, help extended includes setting up village knowledge centers as well as village seed banks via self-help groups, training in product processing, grading and adding marketability, as well as poultry rearing and vermin-composting. In Tanzania, producer marketing groups have been developed and strengthened for farmers to enjoy high farm prices and ensure access to inputs and information.

"Even our hero, Dr Norman Borlaug," Dar says, "Father of the Green Revolution in irrigated Mexico and Asia, found that plant breeding alone could not achieve the same result in Africa." Miracle seeds gave miracle yields, that was all. More than all those wonder seeds were needed. "Too many other systems were dysfunctional. Fertilizer wasn't available, or was too expensive; credit and infrastructure were lacking; and markets were unable to smooth out the yearly variations in grain production." Fertilizer became out of reach to the poor farmer; credit became scarce; government support became inadequate; and markets remained uninterested in investing in the poor producers.

ICRISAT made its own mistakes. Dar says:

At ICRISAT, we attempted the Green Revolution approach. We bred many varieties that showed outstanding performance when well-managed with fertilizer and good soils and weed control. But when they reached the farm, these varieties rarely received such good treatment. They could not express their potential.

"They (farmers) can't eat potential," Norman Borlaug said. "Africa needs inputs, access to markets, infrastructure and credit."

Yes, with The New AI, ICRISAT and partners public and private can help African and Asian farmers to help themselves. Inputs supplied, inputs multiplied. Access to credit, access to transport, access to facilities, access to markets - and in all, access to management. Farmers must become businessmen; farmers must discard dependency and become managers themselves. Now then, for The New AI to succeed, ICRISAT has realized that farmers must learn management, not the least of which is the management of risk such as through farm diversification, that is to say, I must say, the New AI must metamorphose into the new advocacy with innovation and management, transforming into The New AIM. With that, ICRISAT and partners can then wish the good farmers of Asia and Africa:

"May their tribes increase!"

ICRISAT as BBC. Broadcasting seeds of Indian-African synergy, nursing with CGIAR, nurturing & transplanting with 4 Ps partners

2011-03-31T23:40:00.001+08:00

PATANCHERU - Paradigm shift BBC, yes. This has something to do with the new view of the International Crops Research Institute for the Semi-Arid Tropics of itself, even as "ICRISAT has further elevated its role as a bridge, broker and catalyst in the global fight against poverty and hunger," according to William Dar, the Institute's Director General (sitting, at left). From ICRISAT, another amazement for me, another astonishment for the world.

This astounding announcement has the official seal, literally, of the Governing Board of ICRISAT, with Nigel Poole as Chair (standing), made on 23 March 2011 during the 64th GB meeting in New Delhi, India. On that date, the GB launched the ICRISAT South-South Initiative, IS-SI, which aims to "elevate the India-Africa partnership on agricultural development into an international platform," Dar says. Agricultural development is a global challenge that calls for a global response.

The connection between the IS-SI and the "1st Africa-India Economic Mission" conducted 28 February to 05 March 2010 (emrc.be) was not mentioned in the press release, but I came to know about it because I googled for more info on Africa-India partnerships. It is relevant here. The 2010 mission was sponsored by the Belgian EMRC (from the old name European Marketing Research Center) "to foster partnerships between Africa and India" in agriculture research, soil & water management, biofuels, fresh produce, seed value chain, and knowledge parks (icrisat.org). The mission was to learn from India and then "to initiate projects in Africa involving entrepreneurs, investors and Indian researchers" (emrc.be). Everything is connected to everything else - if we connect them.

As the IS-SI does, the 1st Africa-India Economic Mission must have called attention to the need for the partnership of what I call the 4 Ps - public, private, patron and people. The 4 Ps partnership is necessary and providential, because the partnership of government, business, philanthropy & other fund sources with the poor has been refined into an art by ICRISAT.

IS-SI: After India, Africa. After Africa, Asia. After Asia, the world!

Not only that. With the new-view BBC, with what I know after 35 years of immersion in science journalism from shining sea to shining tree, from aquaculture to forestry, with this latest paradigm shift, ICRISAT has officially redefined the role of science agencies in development, and that is to:
Bridge
Broker and
Catalyze.

That's the new BBC, a rebel's view if you consider the age-old, highly entrenched model of Technology Transfer advocated and advanced by the Science Establishment, from Argentina to Zaire. Those within the CGIAR system are learning their lesson from ICRISAT on tech transfer: Don't.

The more famous BBC, of course, is the British Broadcasting Council, a giant multi-media public service arm of United Kingdom, with "its mission (being) to enrich people's lives with programmes that inform, educate and entertain" (bbc.co.uk). BBC has a World Service, which means its mission is to enrich peoples' lives all over the world. "(We are) the largest broadcasting organisation in the world," the BBC says of itself.

If you will note, the BBC of UK assumes the role of the expert or the knowledgeable one communicating with the amateur or the ignorant. That Teacher-Knows-Best attitude is not much unlike the tech transfer attitude of scientists trying to serve the people. In either case, the communication is based on what the scientists think is what the people need, when the scientists have not considered first what the people want.

In selling science as well as in selling goods, in communication as well as in marketing, which is communication applied in commerce, let me be a rebel myself and say: You shouldn't begin with a needs assessment; rather, you should begin with a wants assessment. Having been a copywriter before, I know that the best copywriters know that the best ads are those that show people what they want, not what they need - let the science experts in communication learn from the copywriters!

"The IS-SI is a practical expression of strategic international partnership," Dar says, "on agricultural research-for-development as the driver of prosperity and economic opportunities particularly in the dryland tropics." I would say strategic because it concerns the poor in society and the poor in soils, both in the drylands in the tropics. Bridge, Broker, Catalyze. For handling knowledge for social growth, this new science BBC is demand-driven; the classic technology transfer is supply-pushed. Tech transfer experts, don't push your luck!

A CGIAR study shows that every $1 spent for international agricultural research produces $9 worth of added food in the developing countries. Indeed, science has a multiplier effect of such magnitude when it is used for development. That, of course, is without IS-SI. With IS-SI, ICRISAT hopes not only to multiply the food supply by a factor much higher than 9, but that in fact to make the dryland tropics food-sufficient enough to banish hunger, and income-sufficient enough to banish poverty.

So, with IS-SI and the new BBC as approach to marketing science, from hereon, I will be watching as 15 international science centers of the Consultative Group on International Agricultural Research, CGIAR transform themselves into BBC centers:

Africa Rice Center (based in Benin)
Bioversity International (Rome)
CIAT, Centro Internacional de Agricultura Tropical (Colombia)
CIFOR, Center for International Forestry Research (Indonesia)
CIMMYT, Centro Internacional de Mejoramiento de Maiz y Trigo (Mexico)
CIP, Centro Internacional de la Papa (Peru)
ICARDA, International Center for Agricultural Research in the Dry Areas (Syria)
ICRISAT, International Crops Research Institute for the Semi-Arid Tropics (India)
IFPRI, International Food Policy Research Institute (Washington DC)
IITA, International Institute of Tropical Agriculture (Nigeria)
ILRI, International Livestock Research Institute (Kenya)
IRRI, International Rice Research Institute (Philippines)
IWMI, International Water Management Institute (Sri Lanka)
World Agroforestry Centre (Kenya)
WorldFish Center (Malaysia).

Second-guessing William Dar, I gather that the success of the ICRISAT BBC as the new initiative in partnership, lies in a confluence of factors: more funding, better policies, more effective institutions, better infrastructure, and better access to better inputs, and more rewarding markets for poor farmers.

That is not to say that the Indian-African South-South initiative led by ICRISAT cannot succeed without more of this and more of that. In fact, already "ICRISAT and partners," says Dar, "have been instrumental in the livelihood transformation of many dryland farmers in Kenya, Malawi, Mozambique, Tanzania and Uganda." Meaning, a great many farmers have been enriched by new or improved ICRISAT pigeon pea. Another crop on which ICRISAT did a CPR to revive a dying industry is the planting of the ICRISAT peanut as well as the use of the ICRISAT aflatoxin test in Malawi, and as a result of that, this country regained its position as a major exporter to Europe.

There is more. Consider that the IS-SI is built on knowledge extracted from almost 4 decades of experience of ICRISAT with better varieties in India and Africa. Much knowledge gathered to appreciate, more insights gained to apply resulting in:
more crops dependent on less water
more community watersheds built on less water
more income from less risky farming systems
more cropping from more months of the year
more safe foods from more poor farmers, and
more returns for more farmers along the entire marketing chain.

ICRISAT is a living lesson of an institution that if you want synergy among partners, you have to bridge, broker and catalyze.

IMOD Entrepreneurship. Village pathways out of poverty

2011-03-14T23:24:00.001+08:00

PATANCHERU - ICRISAT invented IMOD in 2010 and this year, wishes to give differential treatment to women in Africa and Asia, its preferential territories. Even before this, the women have caught the eye of ICRISAT Director General William Dar. And I couldn’t approve more; if you want poverty out of Africa and Asia, look at the ladies: The women make the best entrances as entrepreneurs.

And of course, one wonderful thing with plain entrepreneurship is its multiplier effect. With IMOD entrepreneurship, you help one woman to become an entrepreneur and you help not only her family but others who can add value to her output along the market highway, or from whom she depends for inputs. No wonder that during the 3-day Network of Indian Agri-Business Incubation Conference (NIABI 2011), 08 to 10 March 2011 at the ICRISAT campus in Patancheru, a special session on women entrepreneurs in agribusiness was conducted (blog.icrisat.org). This was to look into how more help can be given and more women entrepreneurs launched into their own business ventures. This too was in celebration of the centenary of International Women’s Day.

“Empowerment of women is particularly important to me, as I believe this leads to the empowerment of the nation,” says Madam Pratibha Devisingh Patil, President of India. I note that especially the women, the term they use is “empowering women.” The term I prefer to use is helping the women find their place under the sun. You cannot really empower anyone - she must empower herself.

When the woman truly empowers herself, we all know the woman makes the best money manager - she can turn a dollar into a business. Ask Muhammad Yunus, the inventor of what I’d like to call this time a-dollar-a-business village economy. They call it micro-credit. It has been found that the wives make better business sense than the husbands, because the women think of the family needs first while the men think of their own needs first. The men like to start big; the women like to start small; small is beautiful.

It takes a village. I’m looking at the International Crops Research Institute for the Semi-Arid Tropics based in India and the strategy it calls the Inclusive Market-Oriented Development, IMOD. Inclusive of the poor, inclusive of the whole production and marketing process from farm to foreign market, inclusive of families, inclusive of the village. The poor we must always have with us when we think of pathways out of poverty, especially poor families, given the village.

To insure that production of good and services is sustainable, consider the village, not simply the individual farmers, not simply separate families, not simply selected crops. A village must be the smallest measure of development, not the farmer.

We must link agriculture with industry, Madam Patil says, to promote business in agriculture. Following ICRISAT IMOD, linking small farmers with each other and linking the local with global markets, we promote the growth of villages in the country.

In Sub-Saharan Africa and South Asia, William Dar says, over 60% of women are into agriculture. In India, 70% of farm labor comes from women. If we invest in those women, we are investing for the household, because, Dar says, “women are more likely than men to invest their income in food and basic needs for the household.” It takes a woman to grow a family; it takes families to grow a village; it takes villages to grow a nation.

In the Sahel, with USAID funding, ICRISAT has developed a farming system for badlands that calls for digging ditches and planting fruit trees and vegetables that I shall call here simply as water-ditch agriculture - ICRISAT calls it with a rather indigestible name: bioreclamation of degraded lands.

Pasternak says the impoverished lands are assigned to an association of women - not some sort of punishment or torture but because the badlands are the ones available for ownership and cultivation - and they practice water-ditch agriculture, WADA. WADA involves a local technique called the demi-lune (literally, half luna or moon), where each little ditch dug is shaped like a half circle. The ditches are meant to collect and store rain, after which they are planted with trees that consequently bear fruits despite the unfavorable soil conditions. It’s the water. Water is life.

In Africa, in the village of Sadore some 45 km South of Niamey, the capital of Niger, a fruit-tree nursery is run by 30 ladies, with each woman earning $800 a year, says Dov Pasternak, ICRISAT man in the Sahel (blog.icrisat.org). $800 may be nothing to you, but this is 3 times that of the average income in Niger.

Actually, with WADA the Sadore women practice mixed cropping, as they cultivate both perennial crops and cash crops. They plant in between the trees high-value vegetables such as okra. The tree seedlings they plant come from their own nursery. To be sustainable, you must insure the supply of your own inputs.

One of the tree species grown is the African Moringa (the drumstick tree, Moringa oleifera, Tagalog malunggay, Ilocano marunggay), whose leaves make one of the most nutritious vegetables you can find anywhere. That is to say, the Sadore women grow more nutritious food in less fertile lands, as if to teach the men how to farm rich with poor soils.

Oumou, 35, is the head of a Sadore women’s group practicing water-ditch agriculture. Her husband has always been a millet farmer. In 2009, their village received very little rain and the millet crop failed, but her family with 5 children didn’t go hungry: Oumou’s income from her practice of WADA, which totaled about $900 a year, served them well. If you prepare for a drought by catching the rain when it comes, if you multiply your crops by planting trees and vegetables in the same area, you are going to harvest plenty that will tide you over in times of scarcity.

While the ICRISAT report does not directly state it, it must be that the crop production continues to the marketing process, the women’s group itself being the marketing arm, applying ICRISAT’s approach to growth that it calls IMOD. William Dar says that ICRISAT’s IMOD strategy “identifies successful ways to link poor smallholder farmers with the marketplace to generate (higher) incomes and improve their lives (more)” essentially by themselves.

The women farmers have in fact become what I wish to call IMOD entrepreneurs, whereby individually they are able to generate farm products and as a group they are able to market and enjoy value added along the way from the farm gate to the consumer door wherever it is. With their association, the women farmers have become the traders themselves, eliminating the middlemen and their share of the marketing pie.

Proof of progress, if proof is needed, is that the women of Sadore can now afford to buy clothes and mobile phones, build mud brick houses. Successful as farmer entrepreneurs, working as a group, all within 4 years, the women of Sadore have earned the respect of people, including their husbands, within their villages. Given access to resources, women show who’s the boss.

The water-ditch agriculture that the Sadore women made successful was also tried out in 3 villages in the Zinder region of Niger in the years 2009-2010, with similar success, Pasternak says. This year, 2011, WADA will be extended to 50 villages in Niger, covering 8,000 women.

Pasternak says, “It is my strong conviction that Africa’s new Green Revolution should start by women becoming a significant productive part of the rural economy. The improvement in women’s social status this will bring is a pre-requisite for the economic leap forward so many are hoping for.”

Uh, I look at women entrepreneurs as not merely productive but more contributive to society in general. IMOD entrepreneurship with water-ditch agriculture not simply as women becoming a significant part of the production process but as business people who are members of families in villages that include them as those villages prosper, where the poor who labor become richer. Whatever they do, whatever outstanding work they perform, the women I do not separate from their families, even from their husbands who may be born losers. That’s what I understand as inclusive market-oriented development.

Let’s have thousands and thousands more of IMOD businesses in the villages. I think that with millions of dollars more in funding, ICRISAT should extend IMOD entrepreneurship with water-ditch agriculture to cover 8,000 women in Niger, 8,000 women in Peru, 8,000 women in Syria, 8,000 women in Kenya, 8,000 women in Malaysia and so on and so forth all over Africa and Asia. This is not about gender equality. This is favoring success first and favoring the women next; this is favoring the families that the women favor; this is favoring the villages that the families favor. All in favor of social progress. All-inclusive at the village level, which I believe is the cellular level of social development. If it is not inclusive, progress is biased against the poor.

CGIAR reborn. Creative capitalism for 8 M people in the drylands

2011-02-20T21:45:00.002+08:00

MANILA - No, science isn't naturally exciting; journalists aren’t paying attention either; and experts aren't helping any. No, they don't talk through their hats, but they talk above our heads. In a moment, I will show you that experts and journalists should be paying more attention to the old Bill Gates of Microsoft fame & fortune and the new Bill Gates of philanthropy and philosophy. Through ICRISAT, I am told CGIAR has been reborn; I tell you Bill Gates wasn't reborn yesterday.
With the Bill & Melinda Gates Foundation built on software, Bill Gates is East and the CGIAR built on science is West, and the twain should meet. Actually, they have met, and Bill Gates has been in the last 14 months (as of January 2011) "working with the CGIAR community in further refining and elaborating the Strategic Results Framework, the mega-program structure and the associated funding and operational details" (see his paper "For a sustainable & resilient global agriculture - Bill Gates," 09 December 2009, American Chronicle). Some people are lucky. The CGIAR has had to work its ass off in the past many months to reinvent itself, and to meet the expectations of the Foundation that has pledged for 2009-2013 around $400 million or 80 million dollars a year. What Lola wants, Lola gets - if she gets to work well.
So, the Consultative Group on International Agricultural Research, CGIAR has been busy transforming itself from the old to the new. Today, the CGIAR now has 2 working arms: the Consortium of CGIAR Centers, and the CGIAR Fund – all of the new CGIAR hopefully operating on a common framework with a common fund source. The latest report from the headquarters of ICRISAT at Patancheru is that the Consortium, 15 Centers in all, had met on campus from 13 to 16 February, discussed and approved a common Strategy and Results Framework (ICRISAT Happenings 1454, 18 February 2011). About the mega-programs, MPs, according to Carlos Pérez del Castillo, Chair of the Consortium Board, at the end of the next 3 months the 15 MPs will have been identified. From the MPs shall be derived the Centers' new science projects. The common Fund will decide which projects to finance, how much; it will also monitor the process and the products.
Good news: We are talking of the New CGIAR. Here is its historical chance for Great Science with a Human Face. Bad news: I find that I, journalist am newly accursed. The New CGIAR isn't talking my language. Try this yourself, the statement of the Vision of CGIAR reborn, verbatim, with my slashes ("A New CGIAR," cgiar.org):
/ reduce poverty and hunger,
/ improve human health and nutrition, and
/ enhance ecosystem resilience
through high-quality international
/ agricultural research,
/ partnership and
/ leadership.
A Vision is a Desired Future. My slashes indicate that there are clearly seen 6 independent parts of that New CGIAR Vision. I have a problem with that. Aside from the technical language, the parts don't tell me how everything is related to everything else. It must be holistic, but I see only the hole. You expect journalists to only half-listen when experts speak like that. As nice as this journalist can say, as far as I can see, that's a complicated Vision so, should I congratulate the New CGIAR - or commiserate with it? Both!
Congratulations, CGIAR:
With a complex Vision, you have said nothing daunts you!
Commiseration, CGIAR:
With a complex Vision, you have tied yourself a modern Gordian Knot!
I can't help it: once a copywriter, always a copywriter. And always a dreamer. So now let me be the modern Alexander the Great and with my sharp wit slash! the Gordian Knot is gone. With Merlin's Eyes, in its place this is the Vision I see:
Healthy
Wealthy
Drylands
2020
That's the mantra: "Healthy, Wealthy Drylands 2020." That is to say, 20 healthy families in 20 wealthy villages in 20 provinces in 20 countries in the drylands of both Africa and Asia in 2020. Computing: 20 families times 20 villages times 20 provinces times 20 countries times 2 regions equals 320,000 targets. That gives us 320,000 new, improved families in 10 years. Defining: A healthy family has no serious diseases at the very least, is food-secure, and has cash flow; a wealthy village has its natural resources enriched and exploited only up to its optimum sustainable yield at any time.
Remember, families with enterprises. Arithmetically, 1,600,000 heads (given that a family has 5 members) is not much, but don't forget the multiplier effect of an enterprising family being supported towards self-reliance in a complete process from production to marketing and back. If you're an entrepreneur, your family neighbor is always looking at where the grass is greener - yours.
Now then, let each family entrepreneurship project, FEP be within the purview of a new, improved CGIAR mega-program. Let the 5 Partners do their job: Project, Public, Private, Patron, People. A CGIAR Center initiates an FEP, and well the CGIAR Centers can do that; looking at where they are located, the Centers can cover the whole wide world of agriculture, from soil (seeds, including sperms) to paper (policies, including product marketing):
Africa Rice Center (based in Benin)
Bioversity International (Rome)
CIAT, Centro Internacional de Agricultura Tropical (Colombia)
CIFOR, Center for International Forestry Research (Indonesia)
CIMMYT, Centro Internacional de Mejoramiento de Maiz y Trigo (Mexico)
CIP, Centro Internacional de la Papa (Peru)
ICARDA, International Center for Agricultural Research in the Dry Areas (Syria)
ICRISAT, International Crops Research Institute for the Semi-Arid Tropics (India)
IFPRI, International Food Policy Research Institute (Washington DC)
IITA, International Institute of Tropical Agriculture (Nigeria)
ILRI, International Livestock Research Institute (Kenya)
IRRI, International Rice Research Institute (Philippines)
IWMI, International Water Management Institute (Sri Lanka)
World Agroforestry Centre (Kenya)
WorldFish Center (Malaysia).
Since Bill Gates is now part of the CGIAR for all intents and purposes, to my mind, these 15 CGIAR Centers are better off capitalizing on his intellectual challenge to businessmen, especially US dollar billionaires, to patronize or practice creative capitalism. (For more details on this radical concept, see my "Bill Gates, Nobel Prize for Economics 2008!" iCRiSAT Watch). From a journalist's point of view, science with a human face, or research for improving the quality of life of peoples along with improving their places, is the perfect vehicle for creative capitalism. For creative capitalism in science, the total target beneficiaries are untold millions, and the cost of service in the billions is not a subtraction but an addition.
Now then, for creative science, I suggest that each family enterprise project be based on the Adarsha Watershed Model of ICRISAT, that which has grown a watershed where none grew before after it has grown a village where only families grew before. In fact, the Adarsha Model has been so successful that in 2007 yet, already more than 200,000 families had benefited from it across India, China, Vietnam, Thailand, the Philippines and Rwanda (November 2007, ICRISAT at 35: Triumphant Journey with the Poor in the Drylands, page 38).
Why begin with a watershed? (Calling on the Department of Environment and Natural Resources of my country: This is what reforestation should be about, not to mention afforestation.) We begin with water for the village, because village water is village life.
When the initial family enterprise project has taken off, still within the village let the moving spirits behind that FEP partnership move on to another FEP, and another, and another ... Assuming that in each village a watershed is grown, in 10 years there should be at least 160,000 watersheds rebuilt to productivity, and 3,200,000 new, improved families in various stages of self-reliance, or 8,000,000 people CGIARed above the poverty line, no longer poor. Creative science is now translated into 160 K watersheds alive and 8 M lively human faces touched by science.
Dream. Still, Bill Gates would have approved.

Village-eye view, 2011. Knowledge as capital, by Team ICRISAT

2011-02-04T05:43:00.001+08:00

MANILA - The knowledge revolution is all over your place even if you haven't noticed, it's all over the world even if you haven't heard. This time it's brought to you by Team ICRISAT in the drylands.

I'm thinking of the International Crops Research Institute for the Semi-Arid Tropics whose Director General is William Dar and whose headquarters is based in Patancheru in Andhra Pradesh, India. The part of the knowledge revolution I have in mind is not only in India where ICRISAT is based but actually covers all of the drylands of Asia and Africa, not to mention those of Australia and the Americas. The knowledge revolution in the drylands waged by ICRISAT & partners is new proof, if new proof is needed, of Peter Drucker's contention in the 1960s that knowledge had become the primary capital of the democratic world.

On that revolution, I have just written another book. Just off the press, ICRISAT Innovations Shape the Future of Drylands (2011, 115 pages) is my 4th book published by ICRISAT on the institutional objectives and outputs of ICRISAT; that's 4 books in 4 years, and since my research for these books of essays have always been on the active theories and actual practices of science of this Institute, I have acquired a comprehensive knowledge of those as well as gained a comprehending ken on how they apply to the semi-arid tropics of the world within and without ICRISAT's initial mandate crops of chickpea, peanut, pearl millet, pigeon pea, and sorghum. Some culture acquired on some agriculture.

My understanding is that Team ICRISAT now emphasizes, on one hand, the conduct of the new or improved extension of knowledge and, on the other hand, the content of the new or improved technology for agriculture, which includes the crop. That constitutes a knowledge revolution in itself - it has always been the transfer of technology that has been emphasized and never been the adoption of a users-friendly approach behind the transfer of technology until ICRISAT came along, as we shall see.

Innovation on innovation. If truth be told, my 4th book, as well as the 1st to the 3rd, is itself a new way of popularizing science, that which has never been taught in schools of journalism, never been written about, and never been tackled in workshops for writers. My way is what I called Franciscan in my very first ICRISAT book, Team ICRISAT Champions the Poor, page 4, derived from my baptismal name Francisco and from the fact that I weave in my faith with facts and fancies, my insights with information - art applied to science.

My Franciscan creativity is such that I do not seem to disagree with anything. Ah, that is because I always find ways to express my thoughts on the matter quite indirectly - and for you to find out either my disappointment or desire, you have to read between the lines!

In the book, I write on subjects from A to Z, from Agriculture to Inclusive Marketing to Zones of Creativity - the last of which is the source of my essays' wit and humor.

Here is the list of the chapters of my 2011 Innovations book:

01 ICRISAT’s iMODe. The village as minimum development goal
02 Science journals. World Bank adds value to technical publishing
03 infoDev 2012. ICRISAT, ICT & Nokia in a science context
04 William Dar leads. ICRISAT leads the way
05 Waters of Addakal. Woman, the deadlier species
06 The Saluyot Ambassador. Lessons from India, Philippines
07 Sahel H2O. ICRISAT & AVRDC in Africa
08 Isabela Principle. 1: In dry, don’t look at the water!
09 Isabela Principle. 2: In rain, don’t look at the water!
10 InfoDev means business. ICRISAT means dryland farmers
11 ICRISAT strat. Drylands & the economics of the little
12 ICRISAT IMOD. AT Magazine encourages India’s leaders
13 Hyderabad Declaration. Marketing agribusiness models
14 Grey-Green. Folk wisdom & science grow grass
15 Exploit Science. See Options, Not Obstacles
16 Earth Day 2010. ICRISAT for bracing against perfect storm
17 Dryland challenge. Science, folklore & political will
18 Dar speaks. ICRISAT science with a human face
19 Creative climate science. What ICRISAT can teach US
20 CMU: Blue Oceans and Green Harvests
21 Chickpea on dry. Science steps in, roots go deeper
22 Adarsha Revisited. Impacts of CGIAR research
23 An African Revolution. IMOD Power to the Women!
24 Adarsha Alliance. William Dar as ICRISAT Manager
25 Tanzania & Mali for Mbaazi. The Black Revolution in Africa.

However, rather than briefly discussing the 25 chapters, having just re-viewed the book in its totality, I have come up with what I now call Team ICRISAT's Village-Eye View of Development - essentially looking at the village as the minimum development goal. This is what I call truly users-friendly approach. Users, plural. My village eye sees 4 capital forces contributing to that part of the knowledge revolution spawned by Team ICRISAT:

Village information: ICRISAT has what it calls Village Knowledge Centers (icrisat.org), that which via modern information & communication technologies promptly and properly connect the farmers with questions to the experts with answers or options. ICRISAT's ICT includes the mobile phone and Internet chat. The knowledge centers are run by the Virtual Academy for the Semi-Arid Tropics (VASAT) managed by the Institute & partners. With the Village Knowledge Centers, ICRISAT believes it has "brought about the last-mile connectivity" (vasat.icrisat.ac.in) - that is, reached the unreachable. It is so, as it has encouraged the very last node, the farmers themselves to really connect to the network.

Village cropping: The villages in the semi-arid tropics are water-challenged and disease-prone. Now comes Team ICRISAT with crops that are drought survivors and disease resistors - and yield increasers: chickpea, peanut, pearl millet, pigeon pea, and sweet sorghum. Not only crops; ICRISAT has come up with cropping combinations, irrigation and fertilizer techniques that minimize costs and optimize returns. For instance, corn intercropped with pigeon pea grows well even under droughty conditions. In the Sahel, they can grow crops with only drops of water - via the African Market Garden. And anywhere and everywhere, ICRISAT has found that a bottle capful of fertilizer is enough for each hill of a crop to increase yields optimally. So now, a bagful of fertilizer can feed a village!

Village watershed: The forest is a watershed. I learned that long ago in the government office where I worked the longest, the Forest Research Institute, where being a BS Agriculture graduate I had to learn the art & science of forestry on the run as FORI's Chief Information Officer. One of Team ICRISAT innovations that have been most exciting to me is the Adarsha Watershed, that which has served as model for villagers working in behalf of themselves for progress within their village. The Adarsha villagers grew back the watershed that had disappeared, replenished the underground water table, and succeeded in raising crops and livestock that to this date defy droughts and produce in abundance. The Adarsha concept is now being applied in many places in India, China, Thailand and Vietnam.

Village development: For so long have the poor farmers been denied of the values continually added to their farm produce as it goes out the farm gate and reach the consumers in faraway lands. ICRISAT has come up with its strategic approach up to 2020 that it calls Inclusive Market-Oriented Development, IMOD, that which goes beyond enterprise growth and instead focuses on the progress of a whole village, especially those of poor farmers in the countryside. This is what I have called the economics of the little (see my "ICRISAT strat. Drylands & the economics of the little," 03 December 2010, ICRISAT Watch). The title is mine; the technology is ICRISAT's.

In support of all that village-eye view of development is the public-private-people partnership that Team ICRISAT has vigorously nourished with the government, business and donor sectors working along with the people themselves onsite. Consciously or unconsciously, the ICRISAT-led PPP working relationships employ the village-eye view in carrying out common projects and activities: A critical mass of the villagers is into social development. It must be. Team ICRISAT is merely the pusher; ultimately, the people are the users of knowledge. This is what I mean when I say in the last line of my new book:

You don't wage a revolution alone - you wage a revolution with a party!

“Yes we did, and we will deliver! “- William Dar, ICRISAT DG

2011-02-03T19:47:00.001+08:00

Closing Message, ICRISAT Annual Research Meeting, 04 Feb 2011, ICRISAT Headquarters, Patancheru, Andhra Pradesh, India

By William D Dar, Director General of ICRISAT

Dear colleagues and friends, good afternoon!

I have the feeling that something great has happened here over the past two weeks. It feels like a new ICRISAT has been born.

When we started out on 24 January, I put a number of challenges to you. They were big challenges, requiring change from business as usual. What I have observed is that you took up these challenges with full vigor. You put the Institute first, and your own comfort zone second. You trusted in change. You worked with it, rather than against it.

I congratulate all of you, because you did the right thing. Change offers new and exciting opportunities for us all. We just have to venture out of our comfort zones and look around carefully, under the bushes and over the walls. We will find treasure where we least expect it.

I’m really looking forward to sharing our progress with our stakeholders. Many of them praised our boldness in our new Strategic Plan, but they still wondered whether we would walk the talk. When they learn about what we accomplished here, I believe that they will conclude that “Yes, they did.”

We set aside our own egos. We took the time to listen carefully to each other. We took a disciplined, logical approach to work planning. We began with our four Mission goals – reducing poverty, hunger, malnutrition and environmental degradation in the dry tropics.

We worked logically back from there, describing the Outcomes, Outputs, and Milestones we would need to achieve in order to reach those goals.

All the way along, we were true to our commitment to use a systems perspective and to work across Programs, not in disciplinary isolation. We internalized the new Inclusive Market-Oriented Development (IMOD) framework, and we used it as a unifying strategy so that our research activities will be complementary and coherent.

We also internalized the need to effectively communicate our work to our stakeholders so that they will continue to support us, and to even strengthen and increase that support.

I introduced to you our tagline for IMOD, to capture its essence in three simple words: Innovate. Grow. Prosper. I now realize that this tagline not only describes IMOD. It also describes this great Institution of ours. During these two weeks we have innovated, we have grown, and I am confident that we will now prosper. And it is because of your dedication that this has happened.

Of course, our challenges are far from over. They are just beginning. We’ve taken a very big first step. But now we must go back to our regions and to our partners and to our research activities and approach them in a fresh way.

Our partners will be interested in learning from what we learned. Please take the time to explain the IMOD framework and systems perspective to them, and listen to their suggestions. We need them alongside us as we travel the road ahead. As social media is beginning to show us, there is strength in numbers and in networks. We get stronger as we strengthen our friends and champions.

As this great ARM meeting draws to a close, I want to offer a special thanks to Dave Hoisington for his tireless efforts to put it all together. He really went the extra mile. He made sure that thorough consultation was built into every event on the agenda. And Dave was well served by our great RC team that helped him every step of the way. Every member of our Management Group contributed in important ways to the success of this event.

There are so many others to thank. It’s not easy putting on a two-week intensive event for 160 people. To our Housing and Food Services team, to our Visitors Services, our Security, our Farm, Engineering and Transport Services, IT, and many others – thank you. You made everybody feel welcome as you catered to so many special needs. We all feel like family now.

I asked you a question two weeks ago: “Will we deliver?” To my happy surprise, a number of you shouted out “Yes!” At that point, I knew we were going to succeed. And we proved we could! You came from far away, but you brought your ICRISAT spirit with you all the way. From Poverty Killers to Passionates, from IMOD Crazies to Dryland Transformers, we all helped each other with great enthusiasm.

So now, with the experience of two weeks of hard work behind us, as your servant leader, I want to ask you again:

Will we deliver? (Yes!)

Thank you. That’s the spirit, the culture and the mindset that will help us reach our dreams for the smallholder farmers and their families in the dryland tropics. This is the very essence of the science with a human face that we do.

With that, I now declare the 2011 Global Annual Research Meeting closed. I wish you a safe and pleasant journey home. May we innovate, grow and prosper as we fulfill our promises to the poor and the hungry of the drylands of Asia and sub- Saharan Africa.

Thank you and God bless all of you!

Stop all reforestation! Go ICRISAT Adarsha watershed projects

2011-01-31T23:46:00.001+08:00

MANILA - 35 years ago, I founded and was Editor in Chief of Habitat, the color magazine of the Forest Research Institute based in Los Baños, and I could see thick forests where my team of photographers (Rudy Maningas & Cesar Cabrera) and I visited, from Luzon to the Visayas to Mindanao, gaze at some earnest reforestation projects, and meet some forward-looking loggers, not to mention some enthusiastic environmentalists. Today, alone on my own and having rode the bus from Manila to Roxas in Isabela in Northern Luzon, and again taken the bus from Manila to Legazpi City in Albay in Southern Luzon, a good 1,000 km one way taken together, I can see our forests are gone and our reforestation projects have failed - and not for lack of trying. That is because while our public and private reforestation personalities and personnel have meant business, their methods have meant nothing. The people didn't own the reforestation projects, so they didn't care what happened to them. Not caring is one of the greatest sins in the world.

We used to go up to Baguio City not for the flowers but to smell the pines. Now the scent is gone; the trees have disappeared.

Where have all the pine trees gone?
Gone to flowers, everyone.
When will we ever learn?
When will we ever learn?

Help!

So I go East, young man; I go to India, and enter the campus of the International Crops Research Institute for the Semi-Arid Tropics in Patancheru, Andhra Pradesh. William Dar welcomes me; he is the Director General of ICRISAT. He hands me a soft copy of his new paper, "Combating Hunger and Poverty in the Tropical Drylands of Asia and Africa," which he says will be a chapter of a book main-authored and edited by the Dean of the Faculty of Agriculture of McGill University of Canada. The manuscript documents "some of ICRISAT's breakthroughs that have helped farmers better adapt to the trying conditions" in the semi-arid tropics, and that includes parts of the Philippines. In the SAT, the cultivated lands have the distinct characteristic that water for the crops is lacking when there is no rain, and irrigation water is an extravagance for farmers. In the SAT or elsewhere, when the forest goes, can the water be far behind?

I have been reading Dar's 4,184-word ICRISAT chapter and biting off its content part by part, and digesting slowly; then, serendipity! The insight I gain is that ICRISAT's Adarsha Watershed Model is good not only for India, China, Thailand and Vietnam, but also the Philippines - but in a different light, that is, as a reforestation/afforestation model. Reforestation - rebuilding the forest where logging has devastated both vegetation and soil and, therefore, also its watershed value. Afforestation - growing a forest where none grew before.

I will have to deviate from the way the report is presented, which is from the point of view of the institution itself, and concentrate not on the breakthroughs themselves but how they help the farmers improve their lives. This way, I'm going to avoid explaining such intimidating terms as simulation modeling, geographical information systems, and molecular markers that scientists like to dwell on. I will have to write a book to explain those to the layman like myself!

From Dar's chapter and from what I know of ICRISAT in the 4 years that I have been writing about its aims and accomplishments, the Adarsha watershed is a watershed in natural resources management. The ICRISAT success story of the Adarsha Watershed in Kothapally in Andhra Pradesh is now being emulated in other states in India, including Madhya Pradesh, Rajasthan and Gujarat, as well in China, Vietnam and Thailand. In fact, I have written much about it (see my essay, "Water Lessons of Adarsha. Education began with what scientists didn't know," 02 November 2008, American Chronicle). How credible the Adarsha story is you can see in my World Bank affirmation essay, "Adarsha Revisited. Impacts of CGIAR research," 20 August 2010, American Chronicle).

The Adarsha story is a classic example of villagers learning from experts at the same time that the experts are learning from the villagers - when worlds collide, they must coalesce if they want a newer, better world. I love it when the plans come together. The scientists, along with their public & private partners, learned from the villagers the ancient techniques of water harvesting; the villagers learned from the scientists the modern value of community self-help. Scientists started with technology and ended with psychology; the villagers started with indifference and ended with self-reliance. Now there's one watershed where none stood before. And the people know that it's theirs because they grew it.

Applying my Adarsha insight, in the Philippines, the government should stop all reforestation projects now! and start them anew as Adarsha watershed projects. And each project must be a public-private-people partnership. That is to say, each forestation project should now be seen as a village watershed project with the:

(1) trees planted
(2) underground water replenished via water harvesting structures
(3) surface water captured by the vegetation and blanket of organic matter that cover the soil.

It is the public-private-people partnership that has proven crucial in the Adarsha story. Government comes in with policies; the private sector including non-government organizations come in with advocacy and technical support; and the people come in with themselves.

Ultimately, the quality of the lives of villagers must increase. With an Adarsha-like watershed, Mother Nature is resurrected and taken good care of; from her can come sustainable livelihoods for the villagers. From Dar's chapter, here are a few livelihood opportunities within the villages around an Adarsha-like watershed, this being the source of water for them:

For crops to cash, villagers in Luzon, the Visayas and Mindanao can plant any of the new ICRISAT varieties of chickpea, peanut, pearl millet, pigeon pea, and sorghum. Here's the news from Dar's chapter of the book:

New, improved pearl millet - The ICRISAT HHB 67 Improved is resistant to the disease downy mildew. With this new variety of pearl millet, in partnership with the Haryana Agricultural University of India, ICRISAT has enabled Haryana farmers to save US$6.7 million in their 1st year of cropping. Since there was reduced incidence of downy mildew, the yield was higher than when the farmers planted the old pearl millet.

Short duration chickpea and pigeonpea varieties - The new chickpeas (ICCV 2, KK 2, JG 11) and the new pigeonpea (ICPH 2671) mature in such a short time that they "escape terminal drought," that is, they grow on the moisture available in the soil and are ripe for harvest before the onset of drought or the dry season. To get the maximum from their peas, the farmers need not worry about irrigation, which they can't afford anyway.

Cultivars for the world - ICRISAT has released 6 cultivars of chickpea, peanut, pearl millet, pigeon pea, and sorghum in 144 countries, to help increase the food supply and contribute to global food security by aiding these countries to make available more food sources and products.

Chickpea in India – The release of new ICRISAT varieties of desi and kabuli chickpeas released in Andhra Pradesh has resulted in increases in 3 ways: planted area 11 times wider, harvest 45 times higher, and productivity 4 times more. All this has contributed much to the chickpea industry in India. The desi and kabuli releases are all resistant to Fusarium wilt, a deadly disease of crops.

Crop rotation with wheat - A new ICRISAT pigeon pea cultivar (ICPL 88039) has proved to be excellent for rotation with wheat in the northwestern plains of India. Since it matures 10-12 days earlier than the local cultivar (UPAS 120), it does not delay the sowing of wheat. Farmers in Uttar Pradesh loved it, and by the end of the 2004 rainy season, approximately 1,700 ha were already planted with the new cultivar.

Peanut replacing peanut - ICRISAT's new peanut (ICGV 91114) is now replacing the TMV2 variety in Anantapur, the peanut capital of the world, with 800,000 ha planted to this crop. The new cultivar is early maturing and drought-tolerant; its pod yield is 15% higher than that of the old variety. Its haulm (stalk) yield is 17% higher, good as forage for livestock or fertilizer for the soil.

A smart crop called sweet sorghum - My favorite ICRISAT crop, this is the fuel, food, feed, forage, fence and fertilizer species that is incomparable with any other. From the stalks can be extracted sugar, which can be turned to biofuel (ethanol) or food products. The grains can be prepared as food or feed. After harvest, the stalks make good forage for livestock. The stalks can also serve as fence material. The bagasse can be turned into organic fertilizer.

Planning with such livelihood opportunities in mind, the Philippines (and other Asian and African countries) should now reinvent reforestation / afforestation projects into watershed projects following the Adarsha Watershed Model of ICRISAT. The villagers around watersheds should be involved because they will ultimately be the keepers of the treasures from Mother Nature.

That takes care of production. No, we're not finished. For so long have the farmers been at the mercy of the marketplace. The neo-Adarsha villages in Asia and Africa should now link farmers to markets following the ICRISAT inclusive market-oriented development approach. The IMOD approach sees to it government and the private sector join hands with the farmers so that the farmers get their fair share of the values added to their produce from farm gate up to the market in the farthest country. Society must be market-oriented and include the poor in the entire marketing process from beginning to end and back, aiming for the progress of all. If we don't do this, do not wonder that the poor farmers we will always have with us.

IMOD as The iPod of Science. Out of Africa, out of poverty

2011-01-25T18:40:00.001+08:00

PATANCHERU - I'm saying, I'm seeing: With what it calls IMOD, ICRISAT is going to change the world of research - and the world of the poor farmers in Africa and Asia. Starting now.

We are at the campus of the International Crops Research Institute for the Semi-Arid Tropics, ICRISAT at Patancheru, Andhra Pradesh in India, and we are listening to William Dar, Director General of ICRISAT, as he delivers the Welcome Address at the Annual Research Meeting on 24 January 2011. It's really an Inspirational Address. He's talking to his Team ICRISAT, and it's all about Inclusive Market-Oriented Development, IMOD, the Team's invention.

It's a brilliant speech, the most inspired and inspiring I have ever come across that William Dar has ever delivered. While the speaker may not be a fiery one, the speech is certainly meant to fire up one's imagination and spirit, especially the team spirit, which ICRISAT is well-known for. (You can read the original here: "IMOD: Innovate. Grow. Prosper" in this same blog.)

And why do I call IMOD The iPod of Science? Apple's iPod is a portable media player, especially for music and video. The similarity was not intentional on the part of ICRISAT, but if I write it thus, iMod, you will easily see that it looks and sounds so much like iPod. The iPod is Apple's ground-breaking, best-selling device for delivering music & video to the person, a feast for the eyes and ears anytime as you go anywhere. The iMod is ICRISAT's ground-breaking, best-telling stratagem for delivering theory into practice and devising science into routines that are inventive, productive and at the same time respectful of Mother Nature. It's portable too, so that while you do your science, you can carry the iMod anytime as you go anywhere.

The iMod. Inclusive Market-Oriented Development. 3 concepts in 4 words that has reinvented applied research for the hundreds of millions of poor farm families in the drylands of Africa and Asia, the territorial imperatives of ICRISAT. Unintentionally radical, intentionally sensible.

Inclusive. American Heritage Dictionary says inclusive has 2 senses: 1, taking a great deal or everything within its scope; comprehensive. 2, including the specified extremes or limits as well as the area between them. In iMod, inclusive means, as we shall see, more than anything else, inclusive of the poor.

William Dar had found in 2000, his 1st year as Director General (ICRISAT Annual Report 2001, page 4):

Why this pain amidst plenty? The answer is poverty. The poor simply cannot afford to buy the food they need. Even subsistence farmers usually purchase significant portions of their annual food supply. People go hungry because they are without a productive enterprise - and for a large proportion of the poorest, the main enterprise available to them is agriculture, whether as farmers, laborers, family members, village entrepreneurs, or others.

So: Inclusive = Inclusive of the poor.

Market-Oriented. A market is a public place or gathering for buying & selling; it is itself the business of buying & selling (American Heritage). Thus, marketing is the process whereby the traders or middlemen have their day all day capturing all of the values added to the original merchandise or produce, forgetting the original producer - the farmer. By including the farmer as the middleman in the marketing process, he gets the values added that he deserves.

So: Inclusive Market-Oriented = Inclusive of poor in the whole marketing system. While market-oriented was not invented by ICRISAT, inclusive market-oriented is radical because it includes the poor that have been left out of the marketing process. "They (the poor) cannot be left behind," Dar says. Without the "I" in iMod, he says, it would be "a hollow victory."

Development. 3 words are synonymous in this instance, according to American Heritage Dictionary: development, evolution, progress. The dictionary says the shared meaning of these nouns is "a progression from a simpler or lower to a more advanced, mature or complex form or stage." That's literal. In earlier versions of the concept where iMod has evolved, it is market-oriented enterprise, where the focus is on an income-generating or livelihood project or activity for any individual. In iMod, the focus on the enterprise is elevated into a holistic view of development, that is, the enterprise is a device not simply for personal but more so for social progress. I think not simply of progression but of inclusion of the once-excluded, which is the poor.

So: Inclusive Market-Oriented Development = Inclusive of the poor, inclusive of the whole marketing system, inclusive of enterprises, inclusive of society as a whole. That is the radical idea that ICRISAT has contributed to the world of research for development, R4D.

Since iMod has come out as a creative force for R4D, I'm interested in how it came about. In Manila on 11 January, I was asking William Dar whose idea was it to put inclusive to define market-oriented development, and he said it was his. The complete 4-word concept was born one day, but it really took a year for the whole Institute as well as its public and private partners and other people to come up with it in a year-long intellectual struggle to strategize for 2020 (see ICRISAT Strategic Plan to 2020, 56 pages). When they had come up with the concept of market-oriented development, a breakthrough in itself, William Dar asked where would they put the poor in there? And not only the poor?

My wife told me of the book yesterday but I wasn't interested in it. Today, as she looks over my shoulder writing this and when she learns of what I'm writing up, iMod, and I explain a little of it, she says a book by someone who did not believe in Gloria Macapagal-Arroyo (I did), is also about being inclusive. We happen to know the author personally, so it must be interesting to find out more. Well, I have just googled for it and found the concept of inclusive is used by Cielito Habito, former Director General of the National Economic Development Authority under President Fidel V Ramos, in the very title of his book An Agenda For High And Inclusive Growth In The Philippines (December 2010, Mandaluyong City: Asian Development Bank, 76 pages, downloadable free as pdf).

By inclusive growth, Habito means "overall gains that can permeate through a broader spectrum of the economy" (page 13). What he means is prosperity that can be shared by many more, so that there will be fewer poor. The crucial word there is can - "can permeate" (Habito) - intentionally followed by "can be shared" (Hilario). Inclusive growth, while the term may be new, is the old economic habit of dreaming up packages of good(s) and delivering prosperity to the poor. "Too often," Dar says, "it just didn't happen."

By inclusive development, Dar means a vehicle and gives this metaphor: "It's like building an engine - the engine of development will only move if the parts are designated to work with each other, and placed into a real vehicle connected to real wheels that are ready to roll."

So we have the inclusive idea as used by William Dar, Director General of ICRISAT (based in India), and the inclusive idea as used by Cielito Habito, former Director General of NEDA (Philippines). Both thinkers are Filipinos. Both are thinking smart. Habito is thinking globally and acting locally; Dar is thinking globally and acting globally.

Both are PhD's, Habito in Economics, from Harvard University; Dar in Horticulture, from the University of the Philippines. Dictionary synonyms: growth, development, progress. Thus, at first glance, Habito's inclusive growth is similar in meaning with Dar's inclusive development. Yet, as different as economics is from horticulture, there are a number of dissimilarities in our experts' thinking out of the same thought. Habito's concept of inclusive growth is something old, something borrowed (from the US); Dar's concept of inclusive development is something new, something bold (from the Philippines). The differences I see are these:

In Habito's concept of inclusive growth, growth is the product of progress; in Dar's concept of inclusive development, development is the process of progress itself.

In Habito's inclusive, poverty is a premise; in Dar's inclusive, poverty is the problem.

In Habito's inclusive, you empower the public & private sectors; in Dar's inclusive, you empower the public & the private sectors - and the people, especially the poor.

In Habito's inclusive, the poor anticipate; in Dar's inclusive, the poor participate.

In Habito's inclusive, you wait for the market forces to play out. In Dar's inclusive, you send the team to play out the market forces.

In Habito's inclusive, growth is the end; in Dar's inclusive, development is the means.

In Habito's end, inclusive is faith; in Dar's means, inclusive is fact. Habito's inclusive is a leap of faith; Dar's inclusive is a feat of fact. I say it's time we measured the faith with the meter of the fact.

IMOD: Innovate. Grow. Prosper. – William Dar, ICRISAT

2011-01-25T08:42:00.001+08:00

As Director General of the International Crops Research Institute for the Semi-Arid Tropics, ICRISAT, William Dar delivers this Address at the ICRISAT Annual Research Meeting, 24 January 2011 on campus at ICRISAT Headquarters in Patancheru, Andhra Pradesh, India.

Dear Colleagues,

A very warm welcome to all of you. It is inspiring to me to see all the energy, experience and expertise in this auditorium today.

To me, and I hope to you, this Annual Research Meeting is very special. We have the chance here to renew and reinvigorate ICRISAT in a major way, capitalizing on the intensive strategic deliberations that we all participated in over the past year. We’ve also raised the expectations of our stakeholders who participated on a broad scale.

Now is the time to implement our new strategy. We have to walk the talk. We must get this right.

Our strategy, as you know is about harnessing markets to achieve our four Mission goals: to elevate the poor out of poverty, hunger, malnutrition and environmental degradation across the dry tropics of the developing world. We call this strategy IMOD for short, that is, Inclusive Market-Oriented Development. We also summarize it in three simple words:

Innovate. Grow. Prosper.

Our role as a research-for-development institution is to Innovate. Better and more diverse crops and crop products, better, more resilient and productive cropping systems, and better policies and partnerships are the kinds of innovations that we have promised to the world. But we cannot develop these in a fragmented way. They have to be part of a unified strategy. The strategy that links them together is IMOD.

The word ‘Grow’ signals that our innovations contribute by helping the poor to grow into new and more productive agricultural livelihoods. ‘Grow’ is a dynamic word. It reflects change from one state to another in steady progress over time. Here we mean that, we do not work simply to ease the pain of the poor. We do not accept poverty as an eternal state.

We want change. We work to help them get out of poverty. In IMOD we are saying that we will help the poor move steadily along a path from subsistence farming, to market-oriented farming. So we will look at development differently than we did in the past – we will look at it from the perspective of dynamic change.

To deliver on this promise, we must understand deeply how to enable and motivate this kind of growth. We must consider that all too often, the true poor are left out because they lack the resources and empowerment to change by adopting high technology. They are left behind.

Our approach must be deliberately inclusive of those who need us most. Women and children particularly suffer from poverty, hunger and malnutrition in the tropical drylands. This is especially tragic, because they form the future of the drylands.

They cannot be left behind. IMOD without the “I” would be a hollow victory. We must help the truly poor to participate. And we must not forget the risks. We must ensure that change is accompanied by safety nets and resilience strategies.

If we get it right, our contributions will help the poor to succeed in moving along the IMOD pathway leading to Prosperity.

Prosperous families are no longer hungry and malnourished. They have the skills, the tools, the relationships to markets, and the safety nets that enable them to sustain resilient farms and livelihoods. When the poor achieve this, enabled by ICRISAT and many others, the world will judge that we have done our job right, and have done our job well. We will be strongly appreciated, and the world will support us to expand our impacts further.

Since IMOD is a dynamic strategy of progression from subsistence to market-oriented livelihoods, I think we all realize that we must develop our innovations with a systems perspective in mind. A systems perspective looks at how innovations fit together to make a functioning whole.

To define our systems, we must first identify the targets that we want to reach. By that I mean, we must identify those impacts and outcomes that we believe will deliver the highest payoff towards our Mission goals.

The connection to our Mission is very important. We may be tempted to work on certain topics out of intellectual curiosity, or impact outside of our Mission context, but since we are an applied science organization, our curiosity needs to lead to impacts that we have embraced in our Mission.

Once we’ve defined those top priority impacts and outcomes, we will be able to clearly describe the systems needed to deliver those. We will also be able to identify the constraints and bottlenecks to that delivery. This is where we must innovate solutions.

Not us alone, but us working with partners who will contribute innovations that lie outside our own expertise. So the systems perspective leads us to identify the partners that we need to achieve our highest priorities. In this way our strategy leads us naturally to identify Partnerships with Purpose.

Our partnerships with purpose strategy also helps us to focus. We do not build partnerships just for the sake of boasting that we have hundreds of partners. We build partnerships only as needed to better achieve clearly defined priorities leading to our Mission goals. Purposeful capacity-building follows the same logic.

Taken together, all these aspects of IMOD represent a real change in business as usual. In the past, we mainly looked to our own areas of disciplinary training, developed the best innovations that we could… but then left it to others to figure out how to put these diverse innovations together into an overall package that delivered prosperity for the poor. Too often, it just didn’t happen. We underestimated the challenge of moving from innovations to better-functioning systems in the real world.

Having learned this, we are now committing to broaden and deepen our approach. We will work in teamwork and partnership to understand how the parts fit together into a working whole. We will have a clear idea from the start of how our priority systems work, what obstacles and opportunities we and others will tackle, what we will achieve by when, and how we will fit all the pieces together and share them with the poor.

Its like building an engine – the engine of development will only move if the parts are designed to work with each other, and placed into a real vehicle connected to real wheels that are ready to roll.

Colleagues, I hope these introductory comments have helped to convey to you the importance of our task here, and the great opportunity that we have in front of us. Let us show once again the great team spirit that we all felt as we put our heads together in strategic planning last year. We came up with a rich new IMOD strategy and many exciting ideas.

We agreed to think creatively and innovatively, to be open to change, to take risks, to get out of our comfort zones, to build our capacities and partnerships, and not to just do business as usual. We committed to stronger teamwork, to a systems perspective, and to cultural change towards a learning organization.

Now is the time to show that we meant what we said. Now is the time to walk that talk. Now is the time to reinvigorate the ICRISAT that we all love. The ICRISAT that is the world’s best and most precious institution for applying research to help end poverty, hunger, malnutrition and environmental degradation in the tropical drylands.

The whole world cares about our Mission as much as we do, and counts on us to deliver on our promise. We are all servants here, and it is our privilege to serve this great Mission on behalf of the world.

Will Team ICRISAT deliver? I believe Team ICRISAT will, because I know all of you. I know how strongly you share these beliefs.

Thank you, and I wish all of us the very best of success.

Managing results/losses. The politics/science of climate change

2010-12-22T16:13:00.001+08:00

MANILA - Every so often, an odd thought suddenly appears - and sometimes an old book you were not looking for. What do you do? Welcome the thought, open the book. The thought may change your mind, the book may change your perspective. If you’re in luck, the perfect photograph will appear too.

For the past few days, I have been putting to a semblance of order my little room of about 20 square meters in which I work - I never play; I love what I'm doing and that's play to me - I also sleep here amidst 200 books for me, and for me and my children 2 desktop computers (Celeron and Intel Core i7), 1 laptop (HP Compaq Presario C700), 2 Internet connections (Smart up, Digitel down), and 2 printers (HP LaserJet 1020 for B&W and Canon MP198 for color prints). Put in a creative mind and you will see that this writer of a father is armed to the teeth.

Now my little room looks wider; looks deceive. The mind is freer, I think. Today, 22 December 2010, suddenly, within arm's length, this book appears and so, earnestly, I am re-reading a 42-year old volume I love very much, paperbound; I'm browsing actually, guided by my handwritten notes of years ago - in my hard disk, the latest electronic file authored by me that I can get hold of is that of a book I was writing, Creative Education with the subtitle Within your reach, within your mind dated 06 March 2004, where I mention this older book, author and publisher. It's Peter F Drucker's self-confidence-busting The Age Of Discontinuity with the subtitle Guidelines To Our Changing Society (1968, New York: Harper & Row, 402 pages; the copy I have is published 1969 by National Book Store). For probably 20 years now, I have always associated this book with Drucker's radical thought and have been intellectually guided by it:

Knowledge has become the central capital, the cost center, and the crucial resource of the economy.

I'm not an economist, but I was formally trained as a teacher, graduating from the University of the Philippines, UP in 1965; simultaneously, I informally trained myself as a writer, editor, desktop publisher and knowledge manager - so you can imagine the quadruple impact on me of Drucker identifying knowledge as the new capital. They don't teach that in UP, or any other University for that matter.

That's in the very Preface of Drucker's book, page xi. Beyond that, I have reached page 57 and am reading these last words on that page:

The first question to ask in an innovative organization is: "Is this big enough so that we will have at least a new business, if not a new industry or a new technology if we succeed? If not, we cannot afford the risks." This is a very different question from the ones asked in the managerial organization when it does "long-range planning" or allocates resources. There one tries to minimize the possible loss. In innovation one has to maximize the possible results.

Suddenly a thought comes and surprises me:

What we're doing in climate change affirmative action is more minimizing the possible losses and less maximizing the possible results. We're not being SMART in managing climate change, are we? Sure, what we're doing is Specific, Measurable, Achievable, Realistic, and Time-Bound, but that's not SMART enough.

I have been writing intensely about ICRISAT and climate change since February 2007 in my dedicated blog ICRISAT Watch and the American Chronicle online; I have been writing earnestly about Albay and climate change since June 2010 in my blog iNews Earth as well as in the Chronicle. So it doesn't surprise me that 2 names now pop up in my mind: Albay Governor Joey Salceda and ICRISAT Director General William Dar. Salceda is in the Philippines; Dar is in India; one is soft-spoken, the other is not; both are brilliant leaders and results-driven; both are award-winners; both are Filipinos. One is into politics, the other is into science. Now I see that what they're doing separately though thousands of miles apart are actually running parallel to each other. Now I think that the two should meet, exchange experiences - and then emulate each other, meaning, also do what the other is doing at the same time. When they do, I would mark that as Climate Change Day in my calendar.

What Salceda is doing in Albay along with his provincial government team and proselytizing all over the world, is climate change mitigation, but which he prefers to call disaster risk reduction; he's an economist, so I understand. "Disaster risk reduction is not a cost," Salceda loves to say. "It's an investment." What Dar is doing with his team, the International Crops Research Institute for the Semi-Arid Tropics, ICRISAT, and proselytizing all over Asia and Africa and the Americas, not to mention Australia, is climate change adaptation. "We have climate change-ready crops," Dar likes to say. We should be listening to both of them.

Strange bedfellows? Now maybe I have succeeded in confusing you. Which is precisely my point. First, we have to understand where we're coming from so that we can plan on where to go, and how.

Let us take the ICRISAT sweet sorghum as the case for climate change adaptation, and the Albay mantra of zero casualty in natural disasters as the case for climate change mitigation. Albay appears unique in that aside from climate change, it suffers every now and then from Mayon Volcano erupting and Planet Earth quaking, but there are common grounds. Climate change is the environment striking back as man-made natural disaster. You have flash floods in India and you have flashfloods in Albay, for the same reasons aside from climate change: You have deforested your watersheds; you have destroyed your soils.

We are going to take sweet sorghum as representative of ICRISAT's affirmative action on climate change, and zero casualty of Albay's. That of ICRISAT is climate change adaptation; that of Albay is climate change mitigation. One is action, the other is reaction. That of ICRISAT is more proactive; that of Albay is more reactive. Both are necessary - are they of equal importance? I say:

ICRISAT, when you plant the seeds of sweet sorghum, you are planting a climate change adaptive crop: it is resistant to drought or hot weather, and therefore doesn't need irrigation; it thrives even in an infertile soil; and it has multiple uses: food, feed, fodder, forage, fuel, fertilizer. Your crop is climate-change ready.

Albay, when you plant the seeds of zero casualty, you are planting a climate change mitigation crop: it is resistant to typhoon, flood, and volcanic eruption; it thrives even in an unwelcome environment; and it has multiple effects: commerce continues, education continues, science continues, the arts and the living continue in calm. Your people are climate-change ready.

All that considered, my proposition is this:

That we need to be doing are climate change adaptation and climate change mitigation. That is to say, we need both the crops of sweet sorghum and zero casualty. We have to grow them together, side by side. Even as we do better when we intercrop sweet sorghum with pigeon pea, we have to intercrop ideas. We will also need to be building/rebuilding watersheds and soils.

My further proposition is this:

That ICRISAT and Albay gather their teams and in a 3-day workshop in January 2011 in suburban Legazpi City under the legendary watchful eyes of Daragang Magayon (Beautiful Maiden), work out one common project for the next 10 years that I shall refer to here as Magayon 2020: Sweet sorghum for maximizing results and zero casualty for minimizing losses.

Where there is a scientific will, there is a scientific way. ICRISAT has just come out with its Strategic Plan to 2020, so my proposal fits. ICRISAT's strategic move is called inclusive market-oriented development, IMOD, among other things especially including the poor farmers who are thereby linked directly to the market and all its attendant values added. IMOD transforms the farmers into entrepreneurs like they have never been before. IMOD is a brilliant move. So why not make it inclusive of the poor farmers of Albay? That would be maximizing results.

Where there is a political will, there is a political way. With Magayon 2020 as a common project, ICRISAT and Albay can then rightfully claim that they are into affirmative action/reaction as far as climate change is concerned. ICRISAT and Albay will then be both into innovation and management. Joey Salceda and William Dar will then easily become the Super Co-Champions of Climate Change of the United Nations.

In doing Magayon 2020, ICRISAT and Albay would have proved that to what Drucker implies as the need to choose between minimizing losses and maximizing results, there is another choice: You don't have to choose. You can do both. With climate change, you have to do both.

When you do Adaptation and Mitigation side by side, you turn Climate Change Affirmative Action into a Win-Win Situation.